A kind of CRISPR/Cas9 vector suitable for Clamella scutellaria fs482 and its construction method and application

A technology of FS482, construction method, applied in the fields of biochemistry and molecular biology, which can solve problems such as low knockout efficiency

Active Publication Date: 2022-06-07
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The CRISPR / Cas9 system has been widely used in genome editing of mammalian cells, stem cells, yeast, and bacteria due to its advantages of simple construction, relatively high gene knockout efficiency, strong controllability, and low cost. The relatively complex genetic background caused by the unique habitat of fungi, and the knockout efficiency of the CRISPR / Cas9 system is relatively low in filamentous fungi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of CRISPR/Cas9 vector suitable for Clamella scutellaria fs482 and its construction method and application
  • A kind of CRISPR/Cas9 vector suitable for Clamella scutellaria fs482 and its construction method and application
  • A kind of CRISPR/Cas9 vector suitable for Clamella scutellaria fs482 and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of a knockout vector targeting new backbone diterpenoid biosynthesis genes

[0032] On the basis of the original pFC332 plasmid, pFC332 was PacI Single-enzyme digestion, homology arm sequences were designed on both sides of the Cas9 gene promoter of the pFC332 vector, combined with Escherichia coli ( Dichotomyces cejpii ) FS110 promoter pG base sequence (pG promoter was confirmed by in vitro luciferase transcription activity test and hygromycin resistance gene screening yeast experiment to have stronger transcription activity than pgpdA promoter), design primer sequence pG-F: CATCTAGAGGGCCCGCTTAATgaggaccgctcgtcccctat and pG-R: ctagtaatgcgtagaggtgcgtctgccatggtgatgggac; Dichotomyces cejpii) The FS110 genome was used as the template, and the above-mentioned pG-F and pG-R were used as primers to amplify the pG promoter sequence. PCR program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 10 s, annealing at 55°C for 15 s, extension ...

Embodiment 2

[0039] P. hawaiiense Knockout of P450 Gene Biosynthesis Gene in FS482:

[0040] foreign gene introduction P. hawaiiense The FS482 protoplast method is as follows:

[0041] (1) P. hawaiiense The preparation method of FS482 protoplasts is as follows:

[0042] Pick the right amount P. hawaiiense The hyphae of FS482 were inoculated into 200 mL PDA liquid medium and cultured at 30 °C and 180 r / min for 7 days. Filter the bacterial solution with two layers of gauze, select 2 g (wet weight) of well-grown bacterial balls in a 50 mL centrifuge tube, and wash twice with PBS buffer to fully wash away the residual PDA medium. Weigh 0.15 g of lysozyme (Sigma, USA) and dissolve it in 20 mL of KC buffer (0.6 M KCl, 0.05 M CaCl 2 ), and filtered through a 0.22 μm membrane filter, and added to the washed bacteria balls. Lysate at 28°C and 68 rpm for about 3 hours. Filter the lysate with a 200-mesh filter, filter the hyphae, filter again with 8 layers of sterile lens paper, centrifug...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9 vector suitable for C. shieldia FS482 and its construction method and application. For the first time, the present invention utilizes the novel CRISPR / Cas9 system after promoter optimization to construct a recombinant Pseudomonas shieldiae FS482 strain in which the biosynthesis gene of the new diterpenoid skeleton compound has been knocked out, and establishes a high-efficiency C. The CRISPR / Cas9 gene knockout system of FS482 lays a molecular biological foundation for the elucidation of the biosynthetic mechanism of new active secondary metabolites of Pseudomonas FS482 and the acquisition of more new secondary metabolites with significant biological activity.

Description

technical field [0001] The invention belongs to the technical fields of biochemistry and molecular biology, and in particular relates to a CRISPR / Cas9 vector suitable for Conchitosporium tandem FS482 and a construction method and application thereof. Background technique [0002] deep sea fungi Paraconiothyrium hawaiiense FS482 is a deep-sea species of Contothecoides, which can produce new backbone diterpenoids that inhibit angiotensin-converting enzyme, so it has the potential to explore lead compounds for antihypertensive drugs. On this basis, the P. hawaiiense FS482 underwent genome sequencing to predict biosynthetic gene clusters for novel backbone compounds. It is predicted that this compound is biosynthesized by cluster 66 containing terpenoid cyclase, P450 monooxygenase and methyltransferase, and P450 monooxygenase plays an important role in the formation and modification of its backbone. Therefore, it is necessary to delete P450 to verify its function in the bios...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/80C12N15/66C12R1/645
CPCC12N15/80C12N15/66C12N9/0071
Inventor叶伟章卫民徐诗航李赛妮陈书帅刘昭明张维阳许丽琼
OwnerGUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY