Construction method of porcine TFF1 gene knockout cell line based on CRISPR-Cas9 gene editing technology

A cell line and gene technology, applied in the field of genetic engineering, can solve the problem that there is no pig small intestinal epithelial cell model

Pending Publication Date: 2021-06-08
YANGZHOU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no porcine TFF1 gene knockout vector and TFF1 gene knockout porcine small intestinal epithelial cell model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of porcine TFF1 gene knockout cell line based on CRISPR-Cas9 gene editing technology
  • Construction method of porcine TFF1 gene knockout cell line based on CRISPR-Cas9 gene editing technology
  • Construction method of porcine TFF1 gene knockout cell line based on CRISPR-Cas9 gene editing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] 1. Target site design and sgRNA sequence synthesis:

[0050] According to the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the transcript CDS sequence of the porcine TFF1 gene (accession number: XM_003358973.3) was obtained, and the knockout target site was designed according to the 5' end of the CDS region , using CRISPRDesign (http: / / crispr.mit.edu / ) to design three sgRNA guide sequences sgRNA1, sgRNA2 and sgRNA3, sgRNA1: GCCACAGGATTGAAGCACCA;

[0051] sgRNA2: GTTGTCTGTGGGGTCATCAA;

[0052] sgRNA3: GTGGGGTCATCAACGGCCAC. The base CACC was added to the 5' end of the three sgRNA guide sequences to form a positive-strand sgRNA sequence; the three designed sgRNA guide sequences were reverse-complemented, and the base AAAC was added to the 5'-end to form a negative-strand sgRNA sequence. The three pairs of sgRNA sequences are: TFF1-1F: CACCGCCACAGGATTGAAGCACCA

[0053] TFF1-1R: AAACTGGTGCTTCAATCCTGTGGC

[0054] TFF1-2F: CACCGTTGTCTGTGGGGTCATCAA

[0055] TFF1-2R: AAAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method of a porcine TFF1 gene knockout cell line based on a CRISPR-Cas9 gene editing technology. The TFF1 gene sequence in IPEC-J2 cells is knocked out by adopting the CRISPR / Cas9 technology, and the TFF1 gene knockout IPEC-J2 cell line is established and can be used for functional verification of a TFF1 gene in porcine breeding for disease resistance, and an action mechanism of the TFF1 gene in disease resistance is disclosed.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to the construction of a cell line for specifically targeting and knocking out porcine TFF1 gene by using CRISPR-Cas9. Background technique [0002] The CRISPR-Cas9 system is an adaptive immune system formed during the long-term evolution of bacteria and archaea, which can form a specific defense mechanism against gene introduction caused by phage infection, plasmid binding and transformation. The principle and core key technology of the present invention is that a Cas9 nuclease can recognize and cut dsDNA by using guide RNA. Due to many advantages such as strong operability, low cost, and wide application range, this technology is one of the most promising gene therapy technologies for clinical and application. [0003] Porcine intestinal epithelial cells (IPEC-J2) is a non-transformed intestinal cell line derived from jejunal epithelial cells. It provides a biologically ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N5/10A01K67/027
CPCC12N15/113C12N15/8509C07K14/47A01K67/0276C12N2310/20A01K2207/15A01K2217/075A01K2227/108A01K2267/02
Inventor包文斌渠欢宗秋芳黄小国蔡德敏王海飞
OwnerYANGZHOU UNIV