Leptobotia elongate four-base repetitive unit simple sequence repeat molecular marker establishing method and application thereof
A repeating unit and molecular marker technology, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, recombinant DNA technology, etc. Clear banding effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] A method for constructing a four-base repeating unit microsatellite molecular marker of long thin loach, comprising the following steps:
[0033] (1) Acquisition of microsatellite sequence of long thin loach genome DNA:
[0034] Using the biotin four-base repeat probe to hybridize with the enzyme-cut fragment of the long thin loach genome, and then using the magnetic bead enrichment method to obtain the four-base repeat unit microsatellite fragment in the long thin loach genome, after cloning and positive identification, sequence Finally, 13 microsatellite sites with high polymorphism were screened out, and SSRHunter software was used to search for microsatellite DNA sequences with four-base repeats greater than 5. The 13 microsatellite sites with high polymorphism screened out are as follows:
[0035] >Lef3
[0036] CCAATGAGGTTCGATTTCGCCCCTCCCTACCTGCACTTTCCCTGCTGTGCGCTTGTGTTTATCATATCATATCTATCTATCTATCTATCTATCTATCTATCATGTGTGTATCTGTTTTATCCATGGTAGAAATTACAGATATAATAGAGATTT...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com