Unlock instant, AI-driven research and patent intelligence for your innovation.

Leptobotia elongate four-base repetitive unit simple sequence repeat molecular marker establishing method and application thereof

A repeating unit and molecular marker technology, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, recombinant DNA technology, etc. Clear banding effect

Active Publication Date: 2013-06-26
JIANGHAN UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the existing technology, there is no report on the four-base repeating unit microsatellite molecular marker of long thin loach

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leptobotia elongate four-base repetitive unit simple sequence repeat molecular marker establishing method and application thereof
  • Leptobotia elongate four-base repetitive unit simple sequence repeat molecular marker establishing method and application thereof
  • Leptobotia elongate four-base repetitive unit simple sequence repeat molecular marker establishing method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A method for constructing a four-base repeating unit microsatellite molecular marker of long thin loach, comprising the following steps:

[0033] (1) Acquisition of microsatellite sequence of long thin loach genome DNA:

[0034] Using the biotin four-base repeat probe to hybridize with the enzyme-cut fragment of the long thin loach genome, and then using the magnetic bead enrichment method to obtain the four-base repeat unit microsatellite fragment in the long thin loach genome, after cloning and positive identification, sequence Finally, 13 microsatellite sites with high polymorphism were screened out, and SSRHunter software was used to search for microsatellite DNA sequences with four-base repeats greater than 5. The 13 microsatellite sites with high polymorphism screened out are as follows:

[0035] >Lef3

[0036] CCAATGAGGTTCGATTTCGCCCCTCCCTACCTGCACTTTCCCTGCTGTGCGCTTGTGTTTATCATATCATATCTATCTATCTATCTATCTATCTATCTATCATGTGTGTATCTGTTTTATCCATGGTAGAAATTACAGATATAATAGAGATTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a leptobotia elongate four-base repetitive unit simple sequence repeat (SSR) molecular marker establishing method, and an application thereof. The invention belongs to the field of molecular biological DNA marker technology and application. The SSR molecular marker establishing method comprises the steps of: a leptobotia elongate SSR four-base repetitive unit enriched library is established; screening and sequencing are carried out upon SSR sequence positive clones; according to the leptobotia elongate four-base repetitive core sequence, specific primers are designed on two ends; and through PCR amplification detection, 13 pairs of high-polymorphism SSR molecular markers are obtained by screening. The method provided by the invention is mainly applied in respects such as leptobotia elongate resource monitoring, genetic diversity analysis, genetic map construction, molecular-assisted breeding, and the like.

Description

technical field [0001] The invention belongs to the field of DNA marker technology and application of molecular biology, and in particular relates to a construction method and application of a four-base repeating unit microsatellite molecular marker of long thin loach. Background technique [0002] Long thin loach is a unique fish in China, mainly distributed in the middle and upper reaches of the Yangtze River and its tributaries. Long thin loach is the fastest growing and largest individual among Loach family fishes. Its body color is gorgeous and its meat is delicious. Due to the cascading development of large-scale water conservancy projects in the upper reaches of the Yangtze River, overfishing, environmental pollution and other reasons, the resources of long thin loach have decreased sharply, and it has been included in the "Red List of Species in China". With the development of germplasm protection and restoration, multiplication and release, and artificial breeding,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 刘红艳熊飞
Owner JIANGHAN UNIVERSITY