Supercharge Your Innovation With Domain-Expert AI Agents!

Amaranth EST-SSR marker primer and method for identifying amaranth varieties

A technology of labeling primers and amaranth, applied in the field of molecular biology, to achieve the effects of high polymorphism, effective and reliable results, and effective technical support

Inactive Publication Date: 2018-08-10
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the developed SSR markers mainly include G-SSR (genomic SSR) and EST-SSR (expressed sequence tag SSR). However, there are many amaranth EST sequences registered in the existing amaranth EST database, and the SSRs obtained from the development of EST sequences Marker polymorphisms are more efficient than genomic SSR markers. Therefore, amaranth EST-SSR is used to obtain SSR locus information, and the development of SSR marker primers based on amaranth EST-SSR provides effective guidance for the identification of amaranth germplasm and genetic diversity analysis. Marking Technology, Imminent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amaranth EST-SSR marker primer and method for identifying amaranth varieties
  • Amaranth EST-SSR marker primer and method for identifying amaranth varieties
  • Amaranth EST-SSR marker primer and method for identifying amaranth varieties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1 Utilizes the method for identification of amaranth species by using Amaranth BES-SSR marker primer (CATA) 5

[0027] A method for identifying germplasm resources of amaranth using EST-SSR marker primer (CATA) 5 of amaranth, including the design and synthesis of EST-SSR marker primer (CATA) 5 of amaranth, extraction of total DNA of amaranth, establishment of a total PCR reaction system, PCR amplification program, Polyacrylamide gel electrophoresis conditions and identification of amaranth varieties.

[0028] 1. Design and synthesis of amaranth EST-SSR marker primer (CATA) 5: According to the search results of amaranth EST-SSR site, design and synthesis of amaranth (CATA) 5 EST-SSR marker primers are:

[0029] (CATA)5F: CACGTCCTTCATTCGGATCT;

[0030] (CATA)5R: AATCCCGGAGGTAGGATCAC;

[0031] The specific method is as follows: Based on the 99312 Unigene sequences in the high-throughput transcriptome database of amaranth test-tube plantlets constructed by Liu ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an amaranth EST-SSR marker primer and a method for identifying amaranth varieties. The nucleotide sequence (CATA)5F of the amaranth EST-SSR marker (CATA)5 is CACGTCCTTCATTCGGATCT, and the nucleotide sequence (CATA)5R of the amaranth EST-SSR marker (CATA)5 is AATCCCGGAGGTAGGATCAC. The amaranth EST-SSR marker (CATA)5 has good polymorphism among the amaranth varieties and is clear in spectrum band and stable and reliable. The amaranth EST-SSR marker (CATA)5 is also applicable to germplasm resource identification and genetic diversity analysis of more amaranth plants.

Description

technical field [0001] The present invention relates to a kind of EST-SSR marker primer and its method for identifying crop varieties, in particular to amaranth EST-SSR marker primer (CATA) 5 A method for identifying germplasm resources of amaranth belongs to the field of molecular biology. Background technique [0002] Amaranthaceae ( Amaranthaceae ) Amaranth is an edible annual herb that is rich in nutrients. Amaranthus originated in the tropical and subtropical regions of Central America and Southeast Asia, and China is also one of the origins. Among the plants of the genus Amaranthus, amaranth is rich in germplasm resources, and the growth of amaranth is seriously affected by environmental factors, such as light and temperature. If morphological classification is used, it is easily affected by the growth environment, and it is impossible to achieve reliable and effective classification. It is difficult to effectively distinguish them from biological characters, so it ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 刘生财柳燕潘君飞彭丽云赵春丽王晓赖钟雄张梓浩
Owner FUJIAN AGRI & FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More