Amaranth EST-SSR marker primer and method for identifying amaranth varieties
A technology of labeling primers and amaranth, applied in the field of molecular biology, to achieve the effects of high polymorphism, effective and reliable results, and effective technical support
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1 Utilizes the method for identification of amaranth species by using Amaranth BES-SSR marker primer (CATA) 5
[0027] A method for identifying germplasm resources of amaranth using EST-SSR marker primer (CATA) 5 of amaranth, including the design and synthesis of EST-SSR marker primer (CATA) 5 of amaranth, extraction of total DNA of amaranth, establishment of a total PCR reaction system, PCR amplification program, Polyacrylamide gel electrophoresis conditions and identification of amaranth varieties.
[0028] 1. Design and synthesis of amaranth EST-SSR marker primer (CATA) 5: According to the search results of amaranth EST-SSR site, design and synthesis of amaranth (CATA) 5 EST-SSR marker primers are:
[0029] (CATA)5F: CACGTCCTTCATTCGGATCT;
[0030] (CATA)5R: AATCCCGGAGGTAGGATCAC;
[0031] The specific method is as follows: Based on the 99312 Unigene sequences in the high-throughput transcriptome database of amaranth test-tube plantlets constructed by Liu ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com