Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers and fluorescent probes used for detecting folate metabolism related gene SNP and application

A fluorescent probe and folic acid metabolism technology, applied in the biological field, can solve the problems of insufficiency, cross-contamination of PCR products, and low reliability, and achieve the effects of low cost, accurate and reliable detection results, and good practicability.

Inactive Publication Date: 2018-05-15
SHANGHAI PERSONAL BIOTECH
View PDF20 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method is complicated to operate, and when the sample size is large, it is easy to cause cross-contamination of PCR products, and it is prone to insufficient or excessive digestion, resulting in false negative or false positive results, and low reliability.
Although the specificity of the multiplex PCR method has been improved, the principle of this method is still based on the principle of ordinary PCR, and factors such as primer specificity and low-fidelity Taq enzymes can affect the results
Although the DNA sequencing method is currently the gold standard for genetic diagnosis, the steps are cumbersome, the process is complicated, the reagents are expensive, and cross-contamination between samples is prone to occur, resulting in sequencing failures; in addition, the equipment of the sequencer is beyond that of a general clinical laboratory. Tolerance range
The high-resolution melting curve method is a fast, simple, economical and practical typing method, but genotyping depends on the precision of the temperature control of the instrument, and the false positive is high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and fluorescent probes used for detecting folate metabolism related gene SNP and application
  • Primers and fluorescent probes used for detecting folate metabolism related gene SNP and application
  • Primers and fluorescent probes used for detecting folate metabolism related gene SNP and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0075] 1. Prepare the following primers and probes:

[0076] (1) Primers and fluorescent probes targeting the rs1801133[MTHFR(C677T)] site of methylenetetrahydrofolate reductase gene:

[0077] 677-F: CTGACCTGAAGCACTTGAAGGAGAA

[0078] 677-R: GGGACGATGGGGCAAGTGA

[0079] W677:FAM-ATGAAATCGGCTCCCGC-MGB

[0080] M677:VIC-ATGAAATCGACTCCCGC-MGB

[0081] (2) Primers and fluorescent probes targeting the rs1801131[MTHFR(A1298C)] site of methylenetetrahydrofolate reductase gene:

[0082] 1298-F: TGAAGAGCAAGTCCCCCCAAGG

[0083] 1298-R:CCACTCCAGCATCACTCACTTTG

[0084] W1298: FAM-CAAAGACACTTTCTTCAC-MGB

[0085] M1298: VIC-CAAAGACACTTGCTTCAC-MGB

[0086] (3) Primers and fluorescent probes targeting the site of methionine synthase reductase rs1801394[MTRR(A66G)]:

[0087] 66-F: TTGAAGTGATGAGGAGGTTTCTGTT

[0088] 66-R: GATCTGCAGAAAATCCATGTACCA

[0089] W66: FAM-CTCACATATTTCTTC-MGB

[0090] M66: VIC-CTCACACATTTCTT-MGB

[0091] The above three sets of primers were prepared into a m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers and fluorescent probes used for detecting folate metabolism related gene SNP and an application. The primers include four groups, each group having a corresponding fluorescent probe group in order to perform quick genetic typing to rs1801133, rs1801131, and rs1801394. The primers and fluorescent probes have accurate and reliable detection results and low cost, and have good practicability.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer, a fluorescent probe and an application for detecting the SNP of a gene related to folic acid metabolism. Background technique [0002] Folic acid is one of the vitamin B complexes, which is equivalent to pteroylglutamic acid (PGA). It was extracted and purified by Mitchell (H.K. Mitchell, 1941) from spinach leaves, so it is named folic acid. Folic acid is an important nutrient needed by the body, and it is rich in green leafy vegetables, fruits and animal liver. Folic acid works in the human body in the form of tetrahydrofolate. Tetrahydrofolate is a carrier of one-carbon units, which can carry one-carbon units such as methyl, methylene, and formaldehyde, and participate in the synthesis of amino acids, purines, and pyrimidines in the body. Therefore, folic acid plays an important role in cell division and proliferation, tissue repair and body development. [0003] etc. a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/156C12Q2531/113C12Q2561/101
Inventor 汪元涛朱月艳孙子奎
Owner SHANGHAI PERSONAL BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More