Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-mullerian hormone AMH gene for epinephelus lanceolatus, encoding protein and application of anti-mullerian hormone AMH gene

A technique of Mullerian hormone and saddle grouper, applied in the field of genetic engineering, can solve problems such as the slim chance of catching wild male broodstock

Active Publication Date: 2018-06-29
SUN YAT SEN UNIV
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, due to environmental damage and overfishing, the chances of catching wild male broodstock in natural seas are even slimmer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-mullerian hormone AMH gene for epinephelus lanceolatus, encoding protein and application of anti-mullerian hormone AMH gene
  • Anti-mullerian hormone AMH gene for epinephelus lanceolatus, encoding protein and application of anti-mullerian hormone AMH gene
  • Anti-mullerian hormone AMH gene for epinephelus lanceolatus, encoding protein and application of anti-mullerian hormone AMH gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1. Cloning of saddle grouper anti-Müllerian hormone AMH

[0057] 1. Extraction of total RNA from gonads of saddle grouper

[0058] Take healthy whole grouper fish, anesthetize it with ice bath for about 2 minutes, kill the fish and take samples, separate the gonad tissue, use Trizol reagent to extract the total RNA of gonad of grouper saddle, and its OD 260 / 280 = 1.90.

[0059] 2. Synthesis of the first strand of cDNA

[0060] Get 1 μ g of saddle grouper gonad total RNA sample and carry out DNase treatment to remove the contamination of genomic DNA, mix with RNAOligo dT (sequence shown in SEQ ID NO:3, specifically ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt) is mixed with RNAOligo dT, and the resulting product is placed in Store at -20°C for later use.

[0061] 3. Cloning of complete cDNA sequence of saddle grouper AMH gene

[0062] According to the information in the saddle grouper tran...

Embodiment 2

[0068] Example 2 Expression and plasmid coating of saddle grouper anti-Müllerian hormone AMH recombinant protein

[0069] 1. Construction of recombinant expression plasmids

[0070]Using the pGEM-T plasmid containing the AMH coding gene as a template, a pair of upstream primers SEQ ID NO: 6 (ccggaattcctgcaggtctcacatggaaagc) containing the EcoRI cleavage site and a downstream primer SEQ ID NO: 7 (ccgctcgagtaacggcatccaacactccttcgcc) containing the XhoI cleavage site were designed. PCR amplification obtained a single band with a product size of about 1497bp, and the electrophoresis results were as follows: figure 1 .

[0071] The mature peptide coding sequence of saddle grouper anti-Müllerian hormone AMH was cloned into the prokaryotic expression vector pET32a to obtain the recombinant expression vector pET32a-AMH (the construction process was as follows figure 2 shown). The exogenous gene sequence in the expression vector was confirmed to be correct by sequencing.

[0072] ...

Embodiment 3

[0082] Example 3 Preparation of saddle grouper anti-Müllerian hormone AMH antibody

[0083] The recombinant protein AMH obtained in Example 2 was purified, and the recombinant protein rabbit polyclonal antibody was prepared, and the immunization steps were as follows:

[0084] 1) Dissolve 1 mg of the recovered recombinant protein in PBS buffer, mix and emulsify thoroughly with an equal volume of complete Freund's adjuvant.

[0085] 2) Four male New Zealand white rabbits aged 1-3 weeks were selected, and 0.5 mL of blood was collected before immunization as a sample control. Complete Freund's adjuvant (1:1) was mixed for the first immunization, 0.5mL antigen solution was added to 0.5mL Freund's complete adjuvant, and the emulsion was sucked with a 2mL syringe to eliminate air bubbles in the syringe.

[0086] 3) The immunization dose of each rabbit is 1.5 mL subcutaneous injection. After the first immunization, the rats were boosted with incomplete Freund's adjuvant (IFA) at th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-mullerian hormone AMH gene for epinephelus lanceolatus. A nucleotide sequence of the anti-mullerian hormone AMH gene is shown as SEQ ID NO:1. The invention also discloses protein encoded by the gene, a preparation method for producing anti-mullerian hormone AMH recombinant protein by adopting the anti-mullerian hormone AMH gene as a target gene, and a polyclonal antibody prepared by adopting the anti-mullerian hormone AMH recombinant protein obtained by the method as antigen to immunize animals. The invention further discloses application of anti-mullerian hormone AMH recombinant plasmid to preparation of an inducer in a sex-reversal process of the epinephelus lanceolatus and application of the polyclonal antibody to preparation of detecting agents for different developmental periods of the epinephelus lanceolatus.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a grouper anti-Müllerian hormone AMH gene, a coded protein and an application thereof. Background technique [0002] Anti-Mullerian hormone (AMH), also known as Mullerian inhibitor (mullerian inhibiting substance, MIS), can cause the degeneration of Mullerian ducts during male embryonic development and prevent Named for the development of the female reproductive organs. The AMH gene was originally cloned from cattle. In mammals, embryonic testis development is initiated by the SRY gene on the Y chromosome. With the help of other transcription factors (SF-1, Wt1 and GATA-4), it stimulates the expression of AMH in Sertoli cells in male testes to cause Müller The tubules degenerate and allow the individual to develop in the male direction. AMH can also inhibit cAMP and FSH to indirectly affect the embryonic testis to express Cyp19a1, and the function of Cy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/16C12N15/70C12N1/21C07K14/575C07K16/26G01N33/74
CPCC07K14/575C07K16/26G01N33/74G01N2333/575
Inventor 张勇韩玉龙赵密彭诚杨宇晴李水生刘云张海发林浩然
Owner SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More