Specific dna molecules and their application as promoters or molecular markers
A DNA molecule and sequence technology, applied to specific DNA molecules and their applications as promoters or molecular markers, can solve problems such as affecting gene function and affecting the expression level of target genes, and achieve good application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1. Discovery of promoters and specific SNPs
[0056] Test wheat materials: 34 wheat materials (numbered as C1-34, see Table 1 for specific material information) distributed in different wheat regions in my country with large differences in grain traits were selected as the excavation materials for promoters and polymorphic loci .
[0057] The following steps were performed for each tested wheat material:
[0058] 1. Extract the genomic DNA of the tested wheat material.
[0059] 2. Using the genomic DNA extracted in step 1 as a template, a primer pair consisting of TPP-P-1F and TPP-P-1R is used to perform PCR amplification to obtain a PCR amplification product.
[0060] TPP-P-1F (Sequence 1 of the Sequence Listing): 5'-GAATGTAGCAGTCCACCTAT-3';
[0061] TPP-P-1R (Sequence 2 of the Sequence Listing): 5'-ACGCAGATCAATCATCAGAA-3'.
[0062] 3. Take the PCR amplification product obtained in step 2, and perform cloning and sequencing. 25 clones were tested for each w...
Embodiment 2
[0072] Example 2. Functional verification of promoter
[0073] 1. Construction of recombinant plasmids
[0074] 1. Synthesize the double-stranded DNA molecule shown in Sequence 3 of the Sequence Listing.
[0075] 2. Using the DNA molecule obtained in step 1 as a template, a primer pair composed of TPP-P-TF and TPP-P-TR is used for PCR amplification to obtain a PCR amplification product. In TPP-P-TF, the attB1 sequence is underlined. In TPP-P-TR, the attB2 sequence is underlined.
[0076] TPP-P-TF (sequence 5): 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTC CTCTTGATAAGTGTCGGAGGACC-3';
[0077] TPP-P-TR (sequence 6): 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTC GGCGCACGCAAACAACC-3'.
[0078] 3. The PCR amplification product obtained in step 2 is subjected to BP recombination with the vector pDONR207 to obtain a recombinant plasmid having the DNA molecule shown in nucleotides 217-2497 of sequence 3 in the sequence listing.
[0079] 4. The recombinant plasmid obtained in step 3 undergoes LR r...
Embodiment 3
[0094] Example 3. Genotype detection of large samples using P1 and P2
[0095] See Table 2 for the tested wheat materials.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


