Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific dna molecules and their application as promoters or molecular markers

A DNA molecule and sequence technology, applied to specific DNA molecules and their applications as promoters or molecular markers, can solve problems such as affecting gene function and affecting the expression level of target genes, and achieve good application prospects.

Active Publication Date: 2020-07-24
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have found that the same gene may have different promoter types, and the structure of the promoter directly affects its affinity with RNA polymerase, thereby affecting the expression level of the target gene, and then affecting the function of the gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific dna molecules and their application as promoters or molecular markers
  • Specific dna molecules and their application as promoters or molecular markers
  • Specific dna molecules and their application as promoters or molecular markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1. Discovery of promoters and specific SNPs

[0056] Test wheat materials: 34 wheat materials (numbered as C1-34, see Table 1 for specific material information) distributed in different wheat regions in my country with large differences in grain traits were selected as the excavation materials for promoters and polymorphic loci .

[0057] The following steps were performed for each tested wheat material:

[0058] 1. Extract the genomic DNA of the tested wheat material.

[0059] 2. Using the genomic DNA extracted in step 1 as a template, a primer pair consisting of TPP-P-1F and TPP-P-1R is used to perform PCR amplification to obtain a PCR amplification product.

[0060] TPP-P-1F (Sequence 1 of the Sequence Listing): 5'-GAATGTAGCAGTCCACCTAT-3';

[0061] TPP-P-1R (Sequence 2 of the Sequence Listing): 5'-ACGCAGATCAATCATCAGAA-3'.

[0062] 3. Take the PCR amplification product obtained in step 2, and perform cloning and sequencing. 25 clones were tested for each w...

Embodiment 2

[0072] Example 2. Functional verification of promoter

[0073] 1. Construction of recombinant plasmids

[0074] 1. Synthesize the double-stranded DNA molecule shown in Sequence 3 of the Sequence Listing.

[0075] 2. Using the DNA molecule obtained in step 1 as a template, a primer pair composed of TPP-P-TF and TPP-P-TR is used for PCR amplification to obtain a PCR amplification product. In TPP-P-TF, the attB1 sequence is underlined. In TPP-P-TR, the attB2 sequence is underlined.

[0076] TPP-P-TF (sequence 5): 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTC CTCTTGATAAGTGTCGGAGGACC-3';

[0077] TPP-P-TR (sequence 6): 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTC GGCGCACGCAAACAACC-3'.

[0078] 3. The PCR amplification product obtained in step 2 is subjected to BP recombination with the vector pDONR207 to obtain a recombinant plasmid having the DNA molecule shown in nucleotides 217-2497 of sequence 3 in the sequence listing.

[0079] 4. The recombinant plasmid obtained in step 3 undergoes LR r...

Embodiment 3

[0094] Example 3. Genotype detection of large samples using P1 and P2

[0095] See Table 2 for the tested wheat materials.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific DNA molecule and the application thereof as a promoter or a molecule marker. The specific DNA molecule is firstly protected, which is (a1), (a2), (a3) or (a4): (a1)a DNA molecule shown as the 217-th to the 2497-th nucleotide of sequence 3; (a2) a DNA molecule shown as the 217-th to the 2497-th nucleotide at the terminal of 5' of sequence 4; (a3) a DNA molecule shown as sequence 3; and (a4) a DNA molecule shown as sequence 4. The invention also provides the application of the specific DNA molecule as the promoter. The invention also provides the application of the specific DNA molecule as the molecular marker with wheat grain characteristic. The invention provides two promoters, and can be used for promoting the expression of target genes. The invention develops an SNP locus relating to wheat grain characteristic. The specific DNA molecule has excellent application prospects for wheat with different wheat grain characteristics for breeding.

Description

technical field [0001] The present invention relates to specific DNA molecules and their use as promoters or molecular markers. Background technique [0002] The promoter is a DNA sequence located in the upstream region of the 5' end of the structural gene, which can activate the RNA polymerase, make it accurately combine with the template DNA and have the specificity of transcription initiation. The initiation of transcription is a key stage of gene expression, and an important issue in this stage is the interaction between RNA polymerase and promoter. Studies have found that the same gene may have different promoter types, and the structure of the promoter directly affects its affinity with RNA polymerase, thereby affecting the expression level of the target gene, which in turn affects the function of the gene. [0003] Wheat is one of the important food crops in my country, which directly affects the living standards of the Chinese people and the food security of the cou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11C12N15/113
CPCC12N15/113C12Q1/6895C12Q2600/13C12Q2600/156A01H1/04A01H5/10A01H6/4678C07K14/415C12N9/14C12N9/16C12N15/8216C12N15/8251C12N15/8261C12N15/8262C12Y301/03012Y02A40/146
Inventor 刘红霞张学勇郝晨阳李甜
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI