Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tumor cell microsatellite instability detection system

A technology for microsatellite instability and tumor cells, which is applied in the fields of multiplex fluorescence PCR technology and capillary electrophoresis technology, and can solve the problems of complicated operation, false positive or false negative, and long detection period.

Active Publication Date: 2021-09-14
BEIJING MICROREAD GENE TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The method of immunohistochemistry is susceptible to false positive or false negative results due to the influence of tissue fixation and staining conditions, and the operation is relatively complicated and the detection cycle is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor cell microsatellite instability detection system
  • Tumor cell microsatellite instability detection system
  • Tumor cell microsatellite instability detection system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Colorectal cancer tumor tissue sample A and its corresponding normal tissue samples were detected with an MSI detection system containing 9 sites.

[0101] 1.1 Detection system

[0102] The detection kit includes PCR reaction solution, primer mixture, enzyme mixture, positive control, negative control, internal standard, etc. The primer mixture includes 6 single nucleotide repeat sites and 3 control sites, a total of 9 pairs of primers. The primer sequences are as follows:

[0103] NR-21 primer:

[0104] Forward primer: 5'-GAGTCGCTGGCACAGTTCTA-3'

[0105] Reverse primer: 5'-FAM-ATATTCCTACTCCGCATTCACAC-3'

[0106] NR-24 primer:

[0107] Forward primer: 5'-TTGCTGAATTTTACCTCCTGAC-3'

[0108] Reverse primer: 5'-TAMAR-ATTGTGCCATTGCATTCCAA-3'

[0109] NR-27 Primer:

[0110] Forward primer: 5'-GGAAACAAAGCATTGAAGTCTGCAGT-3'

[0111] Reverse primer: 5'-HEX-GAGGTTCTGAGTCGATAATACTAGC-3'

[0112] BAT-25 primer:

[0113] Forward primer: 5'-CTCGCCTCCAAGAATGTAAGT-3'

[0114...

Embodiment 2

[0151] Colorectal cancer tumor tissue samples B and C and their corresponding normal tissue samples were detected with the MSI detection system containing 12 sites.

[0152] 2.1 Detection system

[0153] The detection kit includes PCR reaction solution, primer mixture, enzyme mixture, positive control, negative control, internal standard, etc. There are 12 pairs of primers used in the examples, and the primer sequences are as follows:

[0154] The sequences of NR-21 primers, NR-24 primers, NR-27 primers, BAT-25 primers, BAT-26 primers, MONO-27 primers, PentaC primers, PentaD primers, and Amel primers are the same as in Example 1.

[0155] Braf V600E primers:

[0156] Forward wild-type primer: 5’-GGTGATTTTG GTCTAGCTAC A T-3'

[0157] Forward mutant primer: 5'- GGTT GGTGATTTTGGTCTAGCTAC GA-3'

[0158] Reverse common primer: 5'-TAMAR-GTTGAGACCTTCAATGACTTTCTA-3'

[0159] UGT1A1*6 locus:

[0160] Forward wild-type primer: 5'-CCTCGTTGTA CATCAGAG CG-3'

[0161] Forward...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tumor cell microsatellite unstable state detection system, which relates to quantitative fluorescent PCR amplification technology and capillary electrophoresis detection technology. This system can amplify the six single nucleotide repeat sites of NR‑21, NR‑24, NR‑27, MONO‑27, BAT‑25, BAT‑26, and simultaneously amplify Braf V600E, UGT1A1*6, UGT1A1*28 loci were typed. On the basis of determining the status of MSI, the detection results can realize the screening of Lynch syndrome and provide reference for the use of irinotecan drugs. The invention also provides a detection kit designed accordingly.

Description

technical field [0001] The invention relates to a multiple fluorescent PCR technology and capillary electrophoresis technology. Simultaneous detection of polymorphisms of 6 single nucleotide repeat microsatellite sites and Braf V600E, UGT1A1*6, UGT1A1*28 sites, to provide reference for the diagnosis and personalized medicine of cancer patients such as colorectal cancer, belonging to biomedicine Clinical molecular diagnostic testing technology in the field. Background technique [0002] Microsatellite sequence refers to a short tandem repeat structure with a core sequence of 1 to 6 bases, and these repeat sequences are distributed throughout the human genome. The phenomenon of microsatellite sequence length change caused by insertion or deletion mutations during DNA replication is called microsatellite instability (Microsatellite Instability, MSI). [0003] Microsatellite instability is caused by a defect in the mismatch repair (MMR) gene. Human mismatch repair genes mainl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/118C12Q2600/156
Inventor 张晔邵苗苗慧娜李琛陈初光
Owner BEIJING MICROREAD GENE TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com