Tumor cell microsatellite instable state detection system

A technology for microsatellite instability and tumor cells, applied in the fields of multiplex fluorescent PCR technology and capillary electrophoresis technology, can solve the problems of false positive or false negative, long detection cycle, complicated operation, etc.

Active Publication Date: 2018-08-07
BEIJING MICROREAD GENE TECH
View PDF4 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The method of immunohistochemistry is susceptible to false positive or false negative results due to the influence of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor cell microsatellite instable state detection system
  • Tumor cell microsatellite instable state detection system
  • Tumor cell microsatellite instable state detection system

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0099] Example 1:

[0100] A 9-site MSI detection system was used to detect colorectal cancer tumor tissue sample A and its corresponding normal tissue samples.

[0101] 1.1 Detection system

[0102] The detection kit includes PCR reaction solution, primer mixture, enzyme mixture, positive control, negative control, internal standard, etc. The primer mixture includes 9 pairs of primers with 6 single nucleotide repeat sites and 3 control sites. The primer sequences are as follows:

[0103] NR-21 primer:

[0104] Forward primer: 5’-GAGTCGCTGGCACAGTTCTA-3’

[0105] Reverse primer: 5’-FAM-ATATTCCTACTCCGCATTCACAC-3’

[0106] NR-24 primer:

[0107] Forward primer: 5’-TTGCTGAATTTTACCTCCTGAC-3’

[0108] Reverse primer: 5’-TAMAR-ATTGTGCCATTGCATTCCAA-3’

[0109] NR-27 primer:

[0110] Forward primer: 5’-GGAAACAAAGCATTGAAGTCTGCAGT-3’

[0111] Reverse primer: 5’-HEX-GAGGTTCTGAGTCGATAATACTAGC-3’

[0112] BAT-25 primer:

[0113] Forward primer: 5’-CTCGCCTCCAAGAATGTAAGT-3’

[0114] Reverse primer: 5’-HEX-TCTGC...

Example Embodiment

[0150] Example 2:

[0151] The 12-site MSI detection system was used to detect colorectal cancer tumor tissue samples B and C and their corresponding normal tissue samples.

[0152] 2.1 Detection system

[0153] The detection kit includes PCR reaction solution, primer mixture, enzyme mixture, positive control, negative control, internal standard, etc. There are 12 pairs of primers used in the examples, and the primer sequences are as follows:

[0154] The sequences of NR-21 primer, NR-24 primer, NR-27 primer, BAT-25 primer, BAT-26 primer, MONO-27 primer, PentaC primer, PentaD primer, and Amel primer are the same as in Example 1.

[0155] Braf V600E primers:

[0156] Forward wild-type primer: 5’-GGTGATTTTG GTCTAGCTAC A T-3’

[0157] Forward mutant primer: 5’- GGTT GGTGATTTTGGTCTAGCTAC GA-3’

[0158] Reverse common primer: 5’-TAMAR-GTTGAGACCTTCAATGACTTTCTA-3’

[0159] UGT1A1*6 sites:

[0160] Forward wild-type primer: 5’-CCTCGTTGTA CATCAGAG CG-3’

[0161] Forward mutant primer: 5’- CCTT ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a tumor cell microsatellite instable state detection system, and relates to quantitative fluorescence PCR (polymerase chain reaction) amplification technologies and capillary electrophoresis detection technologies. The tumor cell microsatellite instable state detection system has the advantages that six mononucleotide repeat sites NR-21, NR-24, NR-27, MONO-27, BAT-25 and BAT-26 can be amplified by the aid of the tumor cell microsatellite instable state detection system, and sites BrafV600E, UGT1A1*6 and UGT1A1*28 can be typed by the aid of the tumor cell microsatelliteinstable state detection system; reference can be provided to checking Lynch syndromes and using irinotecan medicines by detection results on the basis that MSI (microsatellite instable) states are determined. The invention further provides a detection reagent kit designed according to the tumor cell microsatellite instable state detection system.

Description

technical field [0001] The invention relates to a multiple fluorescent PCR technology and capillary electrophoresis technology. Simultaneous detection of polymorphisms of 6 single nucleotide repeat microsatellite sites and Braf V600E, UGT1A1*6, UGT1A1*28 sites, to provide reference for the diagnosis and personalized medicine of cancer patients such as colorectal cancer, belonging to biomedicine Clinical molecular diagnostic testing technology in the field. Background technique [0002] Microsatellite sequence refers to a short tandem repeat structure with a core sequence of 1 to 6 bases, and these repeat sequences are distributed throughout the human genome. The phenomenon of microsatellite sequence length change caused by insertion or deletion mutations during DNA replication is called microsatellite instability (Microsatellite Instability, MSI). [0003] Microsatellite instability is caused by a defect in the mismatch repair (MMR) gene. Human mismatch repair genes mainl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/118C12Q2600/156
Inventor 张晔邵苗苗慧娜李琛陈初光
Owner BEIJING MICROREAD GENE TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap