Tumor cell microsatellite instable state detection system
A technology for microsatellite instability and tumor cells, applied in the fields of multiplex fluorescent PCR technology and capillary electrophoresis technology, can solve the problems of false positive or false negative, long detection cycle, complicated operation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0100] Colorectal cancer tumor tissue sample A and its corresponding normal tissue samples were detected with an MSI detection system containing 9 sites.
[0101] 1.1 Detection system
[0102] The detection kit includes PCR reaction solution, primer mixture, enzyme mixture, positive control, negative control, internal standard, etc. The primer mixture includes 6 single nucleotide repeat sites and 3 control sites, a total of 9 pairs of primers. The primer sequences are as follows:
[0103] NR-21 primer:
[0104] Forward primer: 5'-GAGTCGCTGGCACAGTTCTA-3'
[0105] Reverse primer: 5'-FAM-ATATTCCTACTCCGCATTCACAC-3'
[0106] NR-24 primer:
[0107] Forward primer: 5'-TTGCTGAATTTTACCTCCTGAC-3'
[0108] Reverse primer: 5'-TAMAR-ATTGTGCCATTGCATTCCAA-3'
[0109] NR-27 Primer:
[0110] Forward primer: 5'-GGAAACAAAGCATTGAAGTCTGCAGT-3'
[0111] Reverse primer: 5'-HEX-GAGGTTCTGAGTCGATAATACTAGC-3'
[0112] BAT-25 primer:
[0113] Forward primer: 5'-CTCGCCTCCAAGAATGTAAGT-3'
[0114...
Embodiment 2
[0151] Colorectal cancer tumor tissue samples B and C and their corresponding normal tissue samples were detected with the MSI detection system containing 12 sites.
[0152] 2.1 Detection system
[0153] The detection kit includes PCR reaction solution, primer mixture, enzyme mixture, positive control, negative control, internal standard, etc. There are 12 pairs of primers used in the examples, and the primer sequences are as follows:
[0154] The sequences of NR-21 primers, NR-24 primers, NR-27 primers, BAT-25 primers, BAT-26 primers, MONO-27 primers, PentaC primers, PentaD primers, and Amel primers are the same as in Example 1.
[0155] Braf V600E primers:
[0156] Forward wild-type primer: 5’-GGTGATTTTG GTCTAGCTAC A T-3'
[0157] Forward mutant primer: 5'- GGTT GGTGATTTTGGTCTAGCTAC GA-3'
[0158] Reverse common primer: 5'-TAMAR-GTTGAGACCTTCAATGACTTTCTA-3'
[0159] UGT1A1*6 locus:
[0160] Forward wild-type primer: 5'-CCTCGTTGTA CATCAGAG CG-3'
[0161] Forward...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



