Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene OsHsp70cp-2 related with rice endosperm flour as well as encoding protein and application thereof

A protein and gene technology, applied in the field of genetic engineering, can solve the problem of unclear molecular mechanism of amyloplasts

Active Publication Date: 2018-10-12
INST OF CROP SCI CHINESE ACAD OF AGRI SCI +1
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Except for ssg5, several others have been cloned, but the molecular mechanism regulating amyloplast development is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene OsHsp70cp-2 related with rice endosperm flour as well as encoding protein and application thereof
  • Gene OsHsp70cp-2 related with rice endosperm flour as well as encoding protein and application thereof
  • Gene OsHsp70cp-2 related with rice endosperm flour as well as encoding protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. Discovery of Rice Starch Synthesis Related Sites and Their Encoding Genes

[0040] 1. Starch content distribution analysis and genetic analysis of rice endosperm flour mutant N12

[0041]Among the N22 mutants produced by MNU chemical mutagenesis, an endosperm powdery mutant was screened and named N12.

[0042] Compared with N22, the main feature of N12 is that the seeds have a silty opaque phenotype (see figure 1 ), but the thousand-grain weight of the seeds did not change (see figure 2 ), figure 1 It is shown that N22 has a transparent endosperm, and the N12 endosperm has an opaque phenotype in the center and periphery. This indicated that the gene mutation affected the development of amyloplasts, resulting in changes in the structure and properties of starch granules, resulting in differences in the appearance of endosperm.

[0043] The cross-sections of wild-type and mutant N12 seeds were observed by scanning electron microscopy (see image 3 ), the ...

Embodiment 2

[0078] Embodiment 2, the acquisition and identification of transgenic plants

[0079] 1. Construction of recombinant expression vector

[0080] The genomic DNA of N22 (from the rice germplasm resource bank of Nanjing Agricultural University) was used as a template to perform PCR amplification to obtain the OsHsp70cp-2 gene. The PCR primer sequences are as follows:

[0081] primer3: CCGGCGCGCCAAGCTTCTGCACTAGAGCTAAGCAG (SEQ ID NO. 6);

[0082] primer4: GAATTCCCGGGGATCCGGCGAGGCGAGGAAACCCT (SEQ ID NO. 7).

[0083] primer5: GAATTCCCGGGGATCCATGGCCTCCTTCACCTCCC (SEQ ID NO. 8);

[0084] primer6: TAGCGTTAACACTAGTTCAATTGCTGTCGGTGAAA (SEQ ID NO. 9).

[0085]The above primers primer3 and primer4 are located 2kb upstream of the gene shown in SEQ ID NO.2, the amplified product is the promoter of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCUBi1390 (the vector was digested with HindIII and BamHI) using the INFUSION recombination ki...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene OsHsp70cp-2. The gene OsHsp70cp-2 is a DNA (deoxyribonucleic acid) molecule shown in (1) or (2) or (3) or (4), namely (1) a DNA molecule shown in SEQ ID NO.1; (2) a DNAmolecule shown in SEQ ID NO.2; (3) a DNA molecule which is hybridized with a DNA sequence limited in (1) or (2) under the strict condition and is used for encoding protein; (4) a DNA molecule which has 90% of homology or more with the DNA sequence limited in (1) or (2) or (3) and is used for encoding the protein related with synthesis of plant starch. The protein related with plant endosperm flouraffects the development process of plant amyloplast. The abnormal development of the amyloplast in the plant seeds is caused by inhibiting the expression of the protein encoding gene, so as to culture a transgenic plant with endosperm variation and a transgenic plant with abnormal plant amyloplast.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a rice endosperm amyloplast development-related gene OsHsp70cp-2 and its encoded protein and application. Background technique [0002] Rice is an important food crop and one of the model plants for plant research. Rice seeds accumulate a large amount of starch during the maturation process, which provides the main energy for seed germination and seedling growth and development. At the same time, these considerable amounts of starch also become an important food source for humans. The amount of starch accumulated in rice endosperm often determines the size and weight of the seed. Starch is composed of amylose and amylopectin, and its composition will affect the eating quality of rice. The amyloplast is the place where starch is synthesized, and the starch exists in the amyloplast in the form of starch granules. Seed development is a process in which storage starc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/46
CPCC07K14/415C12N15/8245
Inventor 万建民王益华朱小品王云龙刘喜江玲张文伟田云录刘世家张欣
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More