Genetically engineered bacterium, and applications thereof in preparation of L-phosphinothricin

A technology of genetically engineered bacteria and enzyme genes, applied in the field of microorganisms, can solve problems such as reducing production costs, and achieve the effects of reducing production costs, increasing content, and prolonging half-life

Active Publication Date: 2018-11-13
ZHEJIANG UNIV
View PDF8 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] The invention provides a genetically engineered bacterium and its application in the preparation of L-glufosinate-ammonium, by constructing a genetically engineered bacterium capable of expressing pyridoxal phosphate (PLP) in a large amount in Escherichia coli cells without affecting transaminase activity. Solve the problem of exogenous addition of pyridoxal phosphate (PLP) in the preparation process of chiral amino acids in the prior art, greatly reducing production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium, and applications thereof in preparation of L-phosphinothricin
  • Genetically engineered bacterium, and applications thereof in preparation of L-phosphinothricin
  • Genetically engineered bacterium, and applications thereof in preparation of L-phosphinothricin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Increase intracellular PLP concentration and transaminase activity by expressing key enzymes in the PLP synthesis pathway of Escherichia coli by plasmid expression

[0046] For the key gene epd (D-erythrose-4-phosphate dehydrogenase, GenBanK:

[0047] NP_417402.1), dxs (1-deoxyxylulose-5-phosphate synthase, GenBanK: NP_414954.1) and pdxJ (pyridoxine 5'-phosphate synthase, GenBanK: NP_417059.1), for the convenience of investigation For the effect of increasing the intracellular PLP concentration, the gene was cloned into the pCDFDuet-1 plasmid, sequenced correctly and then transformed into Escherichia coli BL21(DE3) to obtain recombinant bacteria Epd, Dxs and PdxJ.

[0048] Use the recombination method to construct the recombinant plasmids of epd, dxs and pdxJ, and the designed primer sequences are as follows (where Promoter is used to obtain the plasmid fragment, with the empty vector pCDFDuet-1 as a template, and other primers are primers for the target gene,...

Embodiment 2

[0070] Example 2 Increase intracellular PLP concentration and transaminase activity by expressing PLP synthetase PdxST via plasmid

[0071] Except for the PLP synthesis pathway of Escherichia coli itself, the pathways of other bacteria to synthesize PLP are DXP-independent pathways. The DXP-independent PLP synthesis pathway only requires the participation of two enzymes (PdxS, pyridoxal biosynthesis lyase and PdxT, glutamine transamidase), and these two enzymes are clustered in the genome as gene clusters. exists in the form of RBS sequence (that is, PdxST, pyridoxal phosphate synthetase, called PLP synthetase), so the gene can be directly amplified and connected to the plasmid.

[0072] The PdxST gene was cloned from the Bacillus subtilis 168 genome (the corresponding gene sequence is shown in SEQ ID NO.1) and connected to the plasmid pCDFDuet-1. The designed primer sequences were:

[0073] PdxST-F (Bgl II): GGA AGATCT GATGGCTCAAACAGGTACTGA

[0074] PdxST-R (Xhol I): CCG ...

Embodiment 3

[0079] Example 3 Effects of different co-expression strategies on intracellular PLP concentration and transaminase activity

[0080] The expression effect of the double-plasmid co-expression strain has a greater relationship with the copy number of the plasmid. The impact of different plasmid combinations on intracellular PLP concentration and transaminase activity is investigated. The specific implementation methods are as follows:

[0081] The gene sequence PdxST of PLP synthetase was connected to the plasmids pCDFDuet-1, pACYCDuet-1, pETDuet-1 and pRSFDuet-1 respectively, and the primer sequences were the same as in Example 2. After the sequence was correct, the recombinant plasmid pdxST-pCDF of PLP synthetase was obtained , PdxST-pACYC, PdxST-pET and PdxST-pRSF;

[0082] In addition, the sequence of transaminase TA1 was connected to plasmids pCDFduet-1 and pETDuet-1 respectively, and the primers used were:

[0083] TA1-Duet-F(Bgl II) GGA AGATCT GATGAACAGCAATAAAGAGTTAATG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium, and applications thereof in preparation of L-phosphinothricin. The genetically engineered bacterium comprises Escherichia coli and recombinant plasmids transferred into Escherichia coli; the recombinant plasmids contain transaminase gene and pyridoxal phosphate synthetic route enzyme gene; the nucleotide sequence of the transaminase geneis represented by SEQ ID NO.1; the nucleotide sequence of the pyridoxal phosphate synthetic route enzyme gene is represented by SEQ ID NO.2-5. According to the applications, genetic engineering technology is adopted to express ribose-5-phosphate pathway synthesis key gene PdxST in Escherichia coli, or enhance Escherichia coli self PLP synthesis pathway key gene epd, pdxJ, and dxs expression; preparation of the coenzyme reinforced transaminase genetically engineered bacterium through construction is capable of increasing intracellular coenzyme PLP content obviously, avoiding adding of externally-sourced PLP in production of L-phosphinothricin using the genetically engineered bacterium, increasing transaminase enzyme activity and stability obviously, prolonging transaminase half life, reducing production cost, and increasing L-phosphinothricin production efficiency.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a genetically engineered bacterium and its application in preparing L-glufosinate-ammonium. Background technique [0002] Transaminase (EC 2.6.1.X) is a class of enzymes that catalyze transamination, which can catalyze the transfer of the amino group on the amino donor (amino acid or amine) to the prochiral acceptor ketone or ketoacid to obtain a chiral amine or chiral amino acids, and by-product ketones or ketoacids ( figure 1 ), has won the favor of many researchers because of its high selectivity, high conversion rate and mild reaction conditions. [0003] Synthesis of R-sitagliptin catalyzed by transaminases (Savile CK, Janey JM, Mundorff EC, Moore JC, Tam S, Jarvis WR, Colbeck JC, Krebber A, Fleitz FJ, Brands J, Devine PN, Huisman GW, Hughes GJ. Biocatalytic asymmetric synthesis of chiral amines from ketones applied to sitagliptin manufacture. Science 20...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P13/00C12R1/19
CPCC12N9/1096C12N15/70C12P13/001C12Y206/01
Inventor杨立荣蒙丽钧周海胜刘亚运尹新坚徐刚吴坚平
OwnerZHEJIANG UNIV