Nucleic acid aptamer for detecting clenbuterol hydrochloride and screening method and application thereof

A technology of clenbuterol hydrochloride and nucleic acid aptamer, which is applied in the field of biomedicine, can solve the problems of difficult nucleic acid aptamer, less amount of sequence information, long time consumption, etc., and achieves high affinity, high sensitivity and saving synthesis cost. Effect

Active Publication Date: 2018-12-11
HUBEI NORMAL UNIV
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The bottleneck problem lies in: First, compared with biological macromolecules, it is relatively difficult to screen and identify nucleic acid aptamers for small molecule hazards
First, the number of screening rounds is twice that of this patent, which takes too long
Second, it uses the method of TA cloning and sequencing, and the amount of sequence information is relatively small
Third, it uses the fluorescent aptamer-graphene oxide method for application, the aptamer needs fluorescent modification, and the detection cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer for detecting clenbuterol hydrochloride and screening method and application thereof
  • Nucleic acid aptamer for detecting clenbuterol hydrochloride and screening method and application thereof
  • Nucleic acid aptamer for detecting clenbuterol hydrochloride and screening method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 is used to detect the screening of the nucleic acid aptamer of clenbuterol hydrochloride

[0041] 1. Synthesize the random single-stranded DNA library, primers and prepare magnetic beads shown in the following sequence

[0042] (1) Artificially synthesized ssDNA library (5'ATTGGCACTCCACGCATAGG(N) 40 CCTATGCGTGCTACCGTGAA3'shown in SEQ ID NO.13)

[0043] (2) Biotin primer: 5'-CCTATGCGTGGAGTGCCAAT-3'-biotin (shown in SEQ ID NO.14)

[0044] (3) SA magnetic beads (streptavidin-modified magnetic beads) were purchased from Thermofisher Company.

[0045] 2. Incubate the target substance with ssDNA:

[0046] Binding buffer (0.1g CaCl 2 , 0.2g KCl, 0.2g KH 2 PO 4 , 0.1g MgCl 2 .6H 2 O, 8g NaCl, 1.15g Na 2 HPO 4 , 1L) was dissolved, and biotin primers were added (the molar ratio to the library was 2:1) for slow denatured renaturation. Add SA magnetic beads (beads were washed 4 times with binding buffer before use) and immobilized for 30-45min to determine the ...

Embodiment 2

[0105] The secondary structure of embodiment 2 nucleic acid aptamers

[0106] 1. A nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.1

[0107] The secondary structure of the nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.1 was analyzed using the M-fold platform. The results show that its secondary structure has prominent rings and stems, and the Gibbs free energy dG=-16.01, showing that the structure has high stability. Its secondary structure is image 3 shown.

[0108] 2. A nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.2

[0109] The secondary structure of the nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.2 was analyzed using the M-fold platform. The results show that its secondary structure has prominent loops and stems, and the Gibbs free energy dG=-13.76, showing that the structure has high stability. Its secondary structure is Figure 4 shown.

[0110] Performance Analy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a nucleic acid aptamer for detecting clenbuterol hydrochloride. The nucleic acid aptamer is selected from one of following nucleotide sequences shown in SEQ ID NO.1; the nucleicacid aptamers with same lengths are cut from both ends of the nucleotide sequence shown in SEQ ID NO.1, and the cutting length is 1 to 11bp; the nucleic acid aptamers with same cutting lengths of 1 to 11bp at the two ends respectively have the corresponding nucleotide sequences shown in SEQ ID NO.12 to SEQ ID NO.2. The invention also provides a screening method and application of the nucleic acidaptamer. The nucleic acid aptamer has the advantages that the specificity is strong, and the nucleic acid aptamer does not generate crossing reaction with clenbuterol hydrochloride analogues; the affinity is high, and the affinity constant is (42.17+/-8.97) nM; the sensitivity is high; the minimum detection limit of clenbuterol hydrochloride is 1.2ng/mL.

Description

technical field [0001] The invention relates to the field of biomedical technology, in particular to a nucleic acid aptamer for detecting clenbuterol hydrochloride and its screening method and application. Background technique [0002] Clenbuterol hydrochloride (Clenbμterol, CBL), is a β-adrenoceptor agonist, originally used for the treatment of asthma. After CBL enters the livestock and poultry body, it can obviously promote the growth of animals and increase the lean meat rate. Human consumption of the edible parts of animals containing clenbuterol can cause food poisoning. The Ministry of Agriculture of my country strictly prohibited the application of adrenaline in animal production in March 1997 (Nongmufa [1997] No. 3 document). However, driven by economic interests, incidents of CBL exceeding the standard in livestock and poultry products occur from time to time. Therefore, it is necessary to monitor the residues of CBL in livestock and poultry products for a long t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115G01N33/53C12Q1/6869
CPCC12N15/115C12N2310/16C12N2330/31C12Q1/6869G01N33/5308C12Q2535/122C12Q2531/113
Inventor 刘细霞侯建军陆琪王芳侯垚瑶孟晨胡田媛陈思锐
Owner HUBEI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap