Human circular RNA overexpression vector framework and overexpression vector and preparation methods of overexpression vector framework and overexpression vector
An overexpression carrier and circular technology, which is applied in the field of human circular RNA overexpression vector framework, overexpression vector and its preparation, can solve the problems of low efficiency of loop formation, improve the loop formation rate, increase the scope of application, and solve the problem of The effect of low ring formation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] The present invention has constructed the pCMV promoter-Alu cyclization element (Alu cycling components
[0053] -up)-multiple cloning sites-reverse complementary Alu cyclization components-down-BGH pA human circular RNA overexpression vector framework as the main structure, and has been verified by sequencing. The plasmid vector and the lentiviral vector were named pcircRNA 2.2hsa and pcircRNA 2.1hsa, respectively.
[0054] The expression vector patterns of pcircRNA 2.2hsa and pcircRNA 2.1hsa are as follows figure 1 and figure 2 shown.
[0055] The human circular RNA overexpression vector framework vector core element sequence is as follows:
[0056] The sequence of the Alu cyclization components-up is shown in SEQ ID NO:1;
[0057] The sequence of the intronic AG receptor is shown in SEQ ID NO: 3;
[0058] The sequence of the multiple cloning site is shown in SEQ ID NO:5;
[0059] The sequence of SEQ ID NO:5 is: GGATCCGCGCAGGACCGGAATTC;
[0060] The sequence o...
Embodiment 2
[0064] Construction of pcircRNA2.2-hsa_circ_0001982
[0065] Using the human circular RNA overexpression vector framework shown in Example 1, the pcircRNA 2.1-hsa_circ_0001982 overexpression vector (pCMV promoter-reverse complementarity reaction upstream element-hsa_circ_0001982-reverse complementarity Alu cyclization element-BGH pA ). The sequence of the pcircRNA2.2-hsa_circ_0001982 is shown in SEQ ID NO:6.
[0066] The successfully constructed expression vector was transfected into 293T cells, and after 48 hours, qPCR technology was used to detect the up-regulation ratio of hsa_circ_0001982 expression with GAPDH as the internal reference and the empty transfection group as the blank control; then the quantitative analysis of hsa_circ_0001982 expression and The correctness of qualitative analysis of sequence splicing;
[0067] The circRNA PCR identification map and the circRNA overexpression vector colony PCR identification map (899bp) are as follows image 3 and Figure ...
Embodiment 3
[0073] Construction of pcircRNA2.2-CircRNA-14
[0074] Using the human circular RNA overexpression vector framework shown in Example 1, a pcircRNA2.2-CircRNA-14 overexpression vector (pCMV promoter-reverse complementation reaction upstream element-CircRNA-14-reverse complementation Alu ring was constructed) Kleb element-BGH pA). The pcircRNA2.2-CircRNA-14 sequence is shown in SEQ ID NO:7.
[0075] The successfully constructed expression vector was transfected into 293T cells, and 48 hours later, qPCR technology was used to detect the up-regulation ratio of CircRNA-14 expression with GAPDH as the internal reference and the empty transfection group as the blank control; and then the qPCR amplification fragment was sequenced to verify CircRNA-14 The correctness of quantitative analysis of expression and qualitative analysis of sequence splicing;
[0076] The circRNA PCR identification map and the circRNA overexpression vector colony PCR identification map (1599bp) are as follow...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap