Human circular RNA overexpression vector framework and overexpression vector and preparation methods of overexpression vector framework and overexpression vector

An overexpression carrier and circular technology, which is applied in the field of human circular RNA overexpression vector framework, overexpression vector and its preparation, can solve the problems of low efficiency of loop formation, improve the loop formation rate, increase the scope of application, and solve the problem of The effect of low ring formation efficiency

Inactive Publication Date: 2018-12-28
GUANGZHOU BIOSENSE BIOSCI
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The human circular RNA overexpression carrier framework and carrier can be used as a universal circular RNA overexpression carrier, which has achieved a breakthrough in the field of circular RNA overexpression; at the same time, the circular RNA overexpression carrier solves the problem of circRNA in vivo early stage The problem of low efficiency of RNA looping increases the looping rate to 95%, which makes up for the defect that the circRNA precursor does not loop and mainly exists in a linear form, and avoids the false positive problem caused by the linear circRNA precursor to the circular circRNA function; and Greatly improved the overexpression efficiency of circRNA, increasing the overexpression efficiency by 500-2000 times

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human circular RNA overexpression vector framework and overexpression vector and preparation methods of overexpression vector framework and overexpression vector
  • Human circular RNA overexpression vector framework and overexpression vector and preparation methods of overexpression vector framework and overexpression vector
  • Human circular RNA overexpression vector framework and overexpression vector and preparation methods of overexpression vector framework and overexpression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] The present invention has constructed the pCMV promoter-Alu cyclization element (Alu cycling components

[0053] -up)-multiple cloning sites-reverse complementary Alu cyclization components-down-BGH pA human circular RNA overexpression vector framework as the main structure, and has been verified by sequencing. The plasmid vector and the lentiviral vector were named pcircRNA 2.2hsa and pcircRNA 2.1hsa, respectively.

[0054] The expression vector patterns of pcircRNA 2.2hsa and pcircRNA 2.1hsa are as follows figure 1 and figure 2 shown.

[0055] The human circular RNA overexpression vector framework vector core element sequence is as follows:

[0056] The sequence of the Alu cyclization components-up is shown in SEQ ID NO:1;

[0057] The sequence of the intronic AG receptor is shown in SEQ ID NO: 3;

[0058] The sequence of the multiple cloning site is shown in SEQ ID NO:5;

[0059] The sequence of SEQ ID NO:5 is: GGATCCGCGCAGGACCGGAATTC;

[0060] The sequence o...

Embodiment 2

[0064] Construction of pcircRNA2.2-hsa_circ_0001982

[0065] Using the human circular RNA overexpression vector framework shown in Example 1, the pcircRNA 2.1-hsa_circ_0001982 overexpression vector (pCMV promoter-reverse complementarity reaction upstream element-hsa_circ_0001982-reverse complementarity Alu cyclization element-BGH pA ). The sequence of the pcircRNA2.2-hsa_circ_0001982 is shown in SEQ ID NO:6.

[0066] The successfully constructed expression vector was transfected into 293T cells, and after 48 hours, qPCR technology was used to detect the up-regulation ratio of hsa_circ_0001982 expression with GAPDH as the internal reference and the empty transfection group as the blank control; then the quantitative analysis of hsa_circ_0001982 expression and The correctness of qualitative analysis of sequence splicing;

[0067] The circRNA PCR identification map and the circRNA overexpression vector colony PCR identification map (899bp) are as follows image 3 and Figure ...

Embodiment 3

[0073] Construction of pcircRNA2.2-CircRNA-14

[0074] Using the human circular RNA overexpression vector framework shown in Example 1, a pcircRNA2.2-CircRNA-14 overexpression vector (pCMV promoter-reverse complementation reaction upstream element-CircRNA-14-reverse complementation Alu ring was constructed) Kleb element-BGH pA). The pcircRNA2.2-CircRNA-14 sequence is shown in SEQ ID NO:7.

[0075] The successfully constructed expression vector was transfected into 293T cells, and 48 hours later, qPCR technology was used to detect the up-regulation ratio of CircRNA-14 expression with GAPDH as the internal reference and the empty transfection group as the blank control; and then the qPCR amplification fragment was sequenced to verify CircRNA-14 The correctness of quantitative analysis of expression and qualitative analysis of sequence splicing;

[0076] The circRNA PCR identification map and the circRNA overexpression vector colony PCR identification map (1599bp) are as follow...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a human circular RNA overexpression vector framework and overexpression vector and preparation methods of the overexpression vector framework and overexpression vector. The human circular RNA overexpression vector framework and vector can be used as a universal circular RNA overexpression vector, and a breakthrough in the field of circular RNA overexpression is obtained; meanwhile, the circular RNA overexpression vector solves the problem of low RNA cyclization efficiency in the early stage of circRNA in vivo, the cyclization rate is increased to 95%, the defect that a circRNA precursor is not cyclized and mainly exists in a linear form is overcome, and the false positive problem of the circular circRNA function due to a linear circRNA precursor is solved; overexpression efficiency of circRNA is greatly improved, and overexpression efficiency is improved to 500-2,000 times.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a human circular RNA overexpression vector framework, an overexpression vector and a preparation method thereof. Background technique [0002] Circular RNAs (Circular RNAs) are a class of endogenous ncRNA molecules that widely and diversely exist in a variety of biological cells and can regulate gene expression. It was first discovered in RNA viruses in the 1970s. In the following decades, some circRNAs composed of exons were also found in some transcripts, such as colorectal cancer deletion gene transcripts, human Ets-1 gene transcripts, etc., but at that time they were considered to be "transcribed" Noise", did not attract much attention. In recent years, with the rapid development of bioinformatics technology, Salzman et al., Jeck et al., Memczak et al., and Guo et al. have discovered thousands of circRNAs in various cells of humans and mice, respectively. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/11C12N15/10
CPCC12N15/11C12N15/85C12N2310/532
Inventor董先辉王晓香陈业兴周剑
OwnerGUANGZHOU BIOSENSE BIOSCI