Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of a monoclonal antibody in early pregnancy detection of dairy cows and its kit

A monoclonal antibody, early pregnancy technology, applied in the fields of preparation, hybridoma cell lines, applications and kits, monoclonal antibody, can solve the problems of unknown mechanism of action and functional application, shorten the empty pregnancy period, broad application prospects, cost-saving effect

Active Publication Date: 2021-01-26
WUHAN ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, some scholars have further studied and found that Hp protein is secreted in both pregnant and non-pregnant endometrial tissues, but the content is the most abundant in the decidua tissue, followed by the secretory endometrium, and the lowest in the proliferative endometrium. Hp may be an important pregnancy-related protein
Haptoglobin is gaining attention as a new marker protein, but its mechanism of action and functional application in first trimester pregnancy in dairy cows is largely unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a monoclonal antibody in early pregnancy detection of dairy cows and its kit
  • Application of a monoclonal antibody in early pregnancy detection of dairy cows and its kit
  • Application of a monoclonal antibody in early pregnancy detection of dairy cows and its kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035]Example 1: Recombinant baculovirus rBV-hp infects sf9 cells to express Hp

[0036]1. Design of primers

[0037]According to the Hp gene sequence published on GeneBank (NM_001040470), design a pair of specific primers F to amplify Hp gene1 / F2, And insert the NcoI restriction site in the upstream primer, and insert the HindIII restriction site in the downstream primer. The primers were synthesized by Dalian Bao Biological Engineering Co., Ltd. The primers are as follows:

[0038]F1: AAACCATGG CGATGAGCGCCCTGCAA

[0039]NCOI

[0040]F2:TTTAAGCTTTTAGTTGTTAGCGATGG

[0041]HindIII

[0042]2. PCR amplification

[0043]The HP gene fragment was amplified using the RNA from the blood of pregnant cows isolated in our laboratory. The amplification conditions were: ①94℃3 minutes, ②(94℃30 seconds→55℃30 seconds→72℃1 minute 30 seconds) 35 cycles; ③72°C for 10 minutes. After the reaction, it was detected by 0.8% agarose gel electrophoresis.

[0044]3. Construction of recombinant transfer plasmid pFastBacHTB-Hp

[0045]The P...

Embodiment 2

[0056]Example 2: Preparation of monoclonal antibodies

[0057]1) Preparation of monoclonal antibodies

[0058]After the Hp protein expressed by the recombinant baculovirus is purified by column, the protein concentration is calculated according to the formula. The Hp protein was used as an antigen to immunize BALB / C mice.

[0059]The purified Hp protein was used as an immune antigen to immunize 6-week-old female BABLB / C mice for 5 times with an interval of 2-3 weeks. For the first immunization, Hp protein plus an equal amount of Freund's complete adjuvant, the immunization dose was 100 μg / mouse, and the immunization route was subcutaneously injected at multiple points on the back of the neck. Later, Freund's incomplete adjuvant was used. A small amount of blood is collected from the tail 12-15 days after the fourth immunization, and the serum titer is determined by indirect ELISA. If the serum titer is qualified, a booster immunization will be performed three days after fusion. With Hp prote...

Embodiment 3

[0077]Example 3: Hybridoma cell lines secreting monoclonal antibodies against Hp protein

[0078]The embodiment of the present invention discloses a hybridoma cell line that secretes monoclonal antibodies against Hp protein: the hybridoma cell line is a hybridoma cell line of CCTCC NO: C2017119 (ie hybridoma cell line 4F11) And CCTCC NO: C201858 hybridoma cell line (ie hybridoma cell line 12F9).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a hybridoma cell strain, a preparation method, a monoclonal antibody, an application and a kit, and relates to the technical field of animal genetic engineering. The hybridoma cell strain secreting the monoclonal antibody against Hp protein provided by the present invention is a combination of the hybridoma cell strain of CCTCC NO: C2017119 and the hybridoma cell strain of CCTCC NO: C201858. Also disclosed is an anti-Hp protein monoclonal antibody, which is selected from the paired CCTCC NO: the monoclonal antibody secreted by the hybridoma cell line of C2017119 and the monoclonal antibody secreted by the hybridoma cell line of CCTCC NO: C201858 . The antibodies secreted by the two hybridoma cell lines are used to prepare an ELISA kit for detecting early pregnancy in dairy cows. The ELISA kit has good sensitivity and high specificity, and is convenient for earlier detection of early pregnant cows.

Description

Technical field[0001]The invention relates to the technical field of animal genetic engineering, in particular to a hybridoma cell line, a preparation method, a monoclonal antibody, an application and a kit.Background technique[0002]Currently, the most widely used clinical diagnostic methods include rectal examination and ultrasound examination. However, rectal examinations are generally performed within 60 days of breeding cows, and sometimes it takes longer to make a diagnosis. This not only affects the reproductive cycle of the cow, but also affects the performance of the cow's production performance. The ultrasonic detection method is costly and susceptible to infection. Some cattle farms use the cattle pregnancy-associated protein (PAG) ELISA kit, which has not been widely promoted, to make a more reliable judgment 28 days after pregnancy. But these methods can only make accurate diagnosis three weeks after artificial insemination of cows. Research has shown that if empty pregn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/20C12N15/866C07K16/18G01N33/577G01N33/68
Inventor 向敏程蕾胡修忠周源余婕刘晓华王定发夏瑜陶弼菲
Owner WUHAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com