Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of soluble preparation method of bluetongue virus non-structural protein ns3

A bluetongue virus and non-structural protein technology, which is applied in the direction of microorganism-based methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of NS3 protein gene inability to express, stable expression, etc., to achieve suitable It is suitable for popularization and use, has a significant specific expression level, and avoids the effect of low renaturation rate

Active Publication Date: 2019-11-19
SHENZHEN CUSTOMS ANIMAL & PLANT INSPECTION & QUARANTINE TECH CENT
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] One of the purposes of this application is to provide an optimized NS3 protein gene, which solves the shortcoming that the current NS3 protein gene cannot be expressed in the E. coli system or cannot be stably expressed in the E. coli system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of soluble preparation method of bluetongue virus non-structural protein ns3
  • A kind of soluble preparation method of bluetongue virus non-structural protein ns3
  • A kind of soluble preparation method of bluetongue virus non-structural protein ns3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: Optimization of bluetongue virus NS3 protein gene sequence

[0050] (1) Sequence analysis and optimization

[0051] Analyze the original sequence of the open reading frame of the NS3 protein, try to design more than a dozen groups of optimized sequences for single factor experiments, and finally establish the most suitable protein soluble expression for this application after preliminary recombinant expression experiments, SDS-PAGE electrophoresis and Western blot verification. The optimized sequence, its sequence is shown in SEQ ID NO.1.

[0052] Optimized NS3 gene sequence:

[0053] ATGCTGAGCGGTCTGATTCAGCGTTTTGAAGAAGAAAAAACCAAACATAATCAGGATCGTGTTGAAGAACTGTCACTGGTGCGCGTTGATGATACCATTAGCCAGCCGCCGCGTTATGCCCCGAGCGCACCGATGCCGAGCAGCATGCCGACCGTTGCACTGGAAATTCTGGATAAAGCAATGAGTAATACCACCGGTGCAACCCAGACCCAGAAAGCCGAAAAAGCCGCCTTTGCCAGCTATGCAGAAGCATTTCGTGATGATGTTCGTCTGCGTCAGATTAAACGCCATGTTAATGAACAGATTCTGCCGAAACTGAAAAGCGATCTGAGCGGTCTGAAGAAAAAACGTGCAATTATTCATACCACCCTGCTGGT...

Embodiment 2

[0061] Example 2 Construction of prokaryotic expression vector pCold-NS3

[0062] (1) The optimized gene fragment is connected to the vector pColdI

[0063] Restriction endonucleases BamHI and EcoRI double-enzyme digest the optimized NS3 gene and vector pColdI. The enzyme digestion system is as follows:

[0064]

[0065] Under the condition of 37°C, react for 1 h. The digested product was subjected to 1% agarose gel electrophoresis, and was recovered and purified using the agarose gel DNA purification kit from Takara Company.

[0066] The ligation kit DNA Ligation Kit (Mighty Mix> of Takara Company was used to connect the digested product NS3 and pColdI to prepare the recombinant prokaryotic expression vector pCold-NS3 (see figure 2 ). The molar ratio of NS3 and pColdI is about 4:1. Ligate for 1 hour at 16°C. The connection system is as follows:

[0067]

[0068] (2) Conversion of ligated products

[0069] The ligation product was transformed into Escherichia coli...

Embodiment 3

[0072] Example 3 Expression and Purification of Recombinant Protein NS3

[0073] (1) Induced expression

[0074] The plasmid pCold-NS3 with correct sequencing was transformed into expressive Escherichia coli competent cells BL21(De3) by means of heat shock transformation. The colony PCR confirmed the positive bacteria, that is, the expression bacteria containing the recombinant expression plasmid pCold-NS3. Inoculate the expression bacteria containing the recombinant expression plasmid pCold-NS3 into the self-inducing expression medium to induce expression, and the self-inducing medium is Overnight Express TM Instant LB Media, the step of inducing expression: inoculate a small amount of bacterial liquid into 3 mL of LB liquid medium containing Amp, and culture overnight at 37°C. The overnight cultured bacterial solution was added to the Amp-containing self-induction medium at a ratio of 1:100, and the induction time was 24 hours at 15°C. The expression products were analyz...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a sequence optimized BT (bluetongue) virus nonstructural protein NS3 gene, a corresponding expression vector, a host cell and a preparation method of nonstructural protein NS3. The NS3 gene is optimized, a cold shock prokaryotic recombinant expression vector pCold-NS3 is constructed, expressed Escherichia coli BL21 (DE3) is transformed, and the soluble expressed BT virus nonstructural protein NS3 is obtained by inducible expression. The NS3 gene is optimized and expressed for a long time under a low temperature condition by the cold shock expression vector and a self-induced expression medium, and high soluble expression of the BT nonstructural protein NS3 is realized.

Description

technical field [0001] The application relates to the fields of molecular biology and biotechnology, in particular to the construction of an optimized bluetongue virus nonstructural protein NS3 gene and its prokaryotic expression vector. Background technique [0002] Bluetongue (Bluetongue, BT) is a non-contact viral infectious disease of ruminants transmitted mainly by Culicoides, caused by Bluetongue virus (BTV) of the family Reoviridae and Orbiviridae. Bluetongue has been recognized by the World Organization for Animal Health (OIE) as one of the most important diseases affecting ruminants. Among them, NS3 protein is a non-structural protein of BTV, its amino acid sequence is highly conserved and has group specificity, and NS3 is the only membrane protein among BTV proteins. At present, the research on the structure and function of NS3 protein is still not thorough. Relevant scholars believe that the main biological function of NS3 protein may be to cooperate with other p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/14C12N15/46C12N15/70C12N1/21C12R1/19
Inventor 黄超华曹琛福史卫军花群义杨俊兴阮周曦林彦星曾少灵王潇
Owner SHENZHEN CUSTOMS ANIMAL & PLANT INSPECTION & QUARANTINE TECH CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More