Soluble preparation method for BT (bluetongue) virus nonstructural protein NS3
A technology for bluetongue virus and non-structural protein is applied in the field of construction of bluetongue virus non-structural protein NS3 gene and its prokaryotic expression vector, which can solve the problems of inability to express stably and NS3 protein gene incapable of expressing, and achieve specificity. Significant expression, suitable for popularization and use, simple separation and purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Embodiment 1: Optimization of bluetongue virus NS3 protein gene sequence
[0050] (1) Sequence analysis and optimization
[0051] Analyze the original sequence of the open reading frame of the NS3 protein, try to design more than a dozen groups of optimized sequences for single factor experiments, and finally establish the most suitable protein soluble expression for this application after preliminary recombinant expression experiments, SDS-PAGE electrophoresis and Western blot verification. The optimized sequence, its sequence is shown in SEQ ID NO.1.
[0052] Optimized NS3 gene sequence:
[0053] ATGCTGAGCGGTCTGATTCAGCGTTTTGAAGAAGAAAAAACCAAA CATAATCAGGATCGTGTTGAAGAACTGTCACTGGTGCGCGTTGATGATA CCATTAGCCAGCCGCCGCGTTATGCCCCGAGCGCACCGATGCCGAGCAGCATGCCGACCGTTGCACTGGAAATTCTGGATAAAGCAATGAGTAATAC CACCGGTGCAACCCAGACCCAGAAAGCCGAAAAAGCCGCCTTTGCCA GCTATGCAGAAGCATTTCGTGATGATGTTCGTCTGCGTCAGATTAAACG CCATGTTAATGAACAGATTCTGCCGAAACTGAAAAGCGATCTGAGCGG TCTGAAGAAAAAACGTGCAATTATTCATACCACCCT...
Embodiment 2
[0061] Example 2 Construction of prokaryotic expression vector pCold-NS3
[0062] (1) The optimized gene fragment is connected to the vector pColdI
[0063] Restriction endonucleases BamHI and EcoRI double-enzyme digest the optimized NS3 gene and vector pColdI. The enzyme digestion system is as follows:
[0064]
[0065] Under the condition of 37°C, react for 1 h. The digested product was subjected to 1% agarose gel electrophoresis, and was recovered and purified using the agarose gel DNA purification kit from Takara Company.
[0066] The ligation kit DNA Ligation Kit (Mighty Mix> of Takara Company was used to connect the digested product NS3 and pColdI to prepare the recombinant prokaryotic expression vector pCold-NS3 (see figure 2 ). The molar ratio of NS3 and pColdI is about 4:1. Ligate for 1 hour at 16°C. The connection system is as follows:
[0067]
[0068] (2) Conversion of ligated products
[0069] The ligation product was transformed into Escherichia coli...
Embodiment 3
[0072] Example 3 Expression and Purification of Recombinant Protein NS3
[0073] (1) Induced expression
[0074] The plasmid pCold-NS3 with correct sequencing was transformed into expressive Escherichia coli competent cells BL21(De3) by means of heat shock transformation. Colony PCR confirmed the positive bacteria, that is, the expression bacteria containing the recombinant expression plasmid pCold-NS3. Inoculate the expression bacteria containing the recombinant expression plasmid pCold-NS3 into the self-inducing expression medium to induce expression, and the self-inducing medium is Overnight Express TM Instant LB Media, the step of inducing expression: inoculate a small amount of bacterial liquid into 3 mL of LB liquid medium containing Amp, and culture overnight at 37°C. The overnight cultured bacterial solution was added to the Amp-containing self-induction medium at a ratio of 1:100, and the induction time was 24 hours at 15°C. The expression products were analyzed b...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com