Positive reference product using human ADBR1 gene 1165 site CC type as template
A reference product, gene technology, applied in the field of molecular biology, to achieve the effect of solving the problem of quality inspection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] Embodiment: A kind of positive reference product with CC type 1165 of human ADBR1 gene as template
[0021] The GG type positive reference product is a reagent with a base sequence as the main component. The base sequence contains a human ADBR1 gene fragment, and the human ADBR1 gene fragment is 5'-GGCGGGCCCTCGCGCCTCGTGGCCCTGCGCGAGCAGAAGGCGCTCAGGACGCTGGGCATCATCATGGGCGTCTTCACGCT G TGCTGGCTGCCCTTCTTCCTGGCCAACGTGGTGAAGGCCTTCCACCGCGAGCTGGTGCCCGACCGCCTCTTCGTCTTCT-3' (as shown in SEQ NO: 4), wherein the underlined base site is the 1165 site of the human ADBR1 gene, and the 1165 site is used to characterize that the GG type of the human ADBR1 gene can be mutated into a human Location of the CC type of the ADBR1 gene. The GG-type positive reference product also contains a buffer reagent, which is selected from Tris-HCl buffer solution with pH 7.6.
[0022] CC-type positive reference product is a reagent with a base sequence as the main component. The base sequence contains a h...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap