Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Haynaldia villosa vacuolar processing enzyme gene VPE3-V and its silencing vector and application thereof

A technology of tufted wheat and enzyme gene is applied in the field of tufted wheat vacuole processing enzyme gene VPE3-V and its silencing vector, which can solve the problems of unclear disease resistance mechanism and the like

Active Publication Date: 2019-07-02
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2015, Zhu et al. cloned an E3 ubiquitin ligase with a U-box / ARM domain that was rapidly upregulated after being induced by powdery mildew, and named it CMPG1-V. Experiments showed that the gene has E3 ubiquitin ligase activity. CMPG1-V overexpressed plants exhibit broad-spectrum powdery mildew resistance at seedling and adult stages, but the mechanism of resistance is unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Haynaldia villosa vacuolar processing enzyme gene VPE3-V and its silencing vector and application thereof
  • Haynaldia villosa vacuolar processing enzyme gene VPE3-V and its silencing vector and application thereof
  • Haynaldia villosa vacuolar processing enzyme gene VPE3-V and its silencing vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Utilize yeast two-hybrid screening CMPG1-V interacting protein, and clone VPE3-V gene

[0026] Dust wheat (Haynaldia villosa L.2n=14, VV) is an annual or perennial cross-pollinated wild relative of wheat, resistant to powdery mildew, rust, shuttle mosaic, take-all, spikelet number Excellent traits such as polysaccharides, drought tolerance and high grain protein content (Chen et al., 2013; Fu et al., 2017; He et al., 2017). In 2015, Zhu et al. cloned CMPG1-V located on 6V from A. pilosa, which played a role in powdery mildew resistance (reference: Zhu, Y. et al. E3 ubiquitin ligase gene CMPG1-V from Haynaldia villosa L. contributes to powdery mildew resistance in common wheat (Triticum aestivum L.). The Plant Journal. 2015.84, 154-168). In order to explore the mechanism of CMPG1-V-mediated powdery mildew resistance, using CMPG1-V as bait, the yeast two-hybrid cDNA library was screened by polyethylene glycol-lithium acetate transformation method, and an intera...

Embodiment 2

[0027] Example 2 The expression characteristics of VPE3-V gene induced by powdery mildew

[0028] T. villosa (Haynaldia villosa, accession no. 91C43, genome VV, 2n=14) was introduced from Cambridge Botanic Garden, UK by our laboratory. Sow the seeds of the powdery mildew-resistant wheat strain 91C43 (references: Qi Lili, Chen Peidu, et al., New source of resistance to powdery mildew in wheat—gene Pm21, Acta Crops, 1995, 21(3):257-262) Germinate in a dish, then orderly transfer to a 15 cm diameter petri dish covered with filter paper, continue to grow until the roots and leaves are about 3-5 cm, and then transfer to a 100-hole box for water cultivation, the culture condition is 20-23 ℃, 14h light / 10h dark, humidity 70%, pay attention to changing water during the period. When T. villosa grows to the three-leaf one-heart stage, select plants with basically the same growth state, and inoculate mixed powdery mildew with mixed powdery mildew, spraying chitin with a concentration of...

Embodiment 3

[0030] Example 3 Construction of VPE3-V gene RNAi silencing vector

[0031] Using the C. villosa cDNA induced by powdery mildew as a template, the primer pair P5 (CGGGATCCTTCCGCTATCGCTGCTGCTCCT, SEQ ID NO.8) and P6 (GGGGTACCTAGTTCTGGTAGCCGTTGGA, SEQ ID NO. .9) Carry out PCR amplification, and recover the amplified fragment. Insert the amplified target fragment into the vector pWMB006 by double digestion with BamHI and KpnI (references: Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile genefusion marker in higher plants. EMBO J.1987 , 6:3901-3907) between the multiple cloning site BamHI and KpnI behind the Ubiquitin promoter; with the primer P7 (CGAGCTCTTCCGCTATCGCTGCTGCTCCT, SEQ ID NO.3) that can specifically amplify the VPE3-V gene fragment (SEQ ID NO.3). 10) and P8 (GACTAGTTAGTTCTGGTAGCCGTTGGA, SEQ ID NO.11) were amplified by PCR, and the amplified fragment was recovered. The amplified target fragment was inserted between the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a haynaldia villosa vacuolar processing enzyme gene VPE3-V and its silencing vector and an application thereof. A cDNA sequence of VPE3-V is SEQ ID NO. 1 and its encoded aminoacid sequence is SEQ ID NO. 2. The gene derives from diploid haynaldia villosa (haynaldia villosa VV, 2n=14), and interacts with the powdery mildew resistance-related gene CMPG1-V, and is mainly located in a cell membrane, and in the powdery mildew resistant diploid haynaldia villosa, the gene is down-regulated significantly after being induced by powdery mildew. Through transient expression and transgenic experiments, the gene is transformed to an infected wheat variety Yangmai 158, and the results show that the silencing wheat VPE3 can improve the resistance to powdery mildew of Yangmai 158.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses a vacuolar processing enzyme gene VPE3-V of wheat tufts and its silencing carrier and application. Background technique [0002] Wheat powdery mildew is a fungal disease of wheat caused by the obligate parasitic fungus Blumeria graminis f.sptritici (Bgt), which seriously affects wheat production. With the influence of cultivars, cultivation conditions and climatic conditions, the harm of wheat powdery mildew is increasing at present, and it is distributed in all major wheat-producing countries. It is common in Shandong coastal areas, Sichuan, Guizhou and Yunnan, and the damage is also serious. In recent years, the disease has also become more and more serious in the Northeast, North China, and Northwest wheat regions. [0003] Wheat powdery mildew can infect the above-ground parts of wheat plants, mainly infecting leaves and leaf sheaths, and generally occurs more on the front of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N9/50C12N15/82A01H5/00A01H6/46
CPCC12N9/63C12N15/8218C12N15/8282
Inventor 王秀娥郝永利王宗宽刘佳张旭吴承云袁春霞邢莉萍曹爱忠肖进王海燕
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More