Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High thebaine poppy and methods of producing the same

A technology of thebaine, poppy, applied in the field of high-level thebaine poppy and its production

Pending Publication Date: 2019-08-02
API LABS INC
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, abrogation of COR activity resulted in the accumulation of reticuline, the seven enzymatic steps preceding COR, rather than codeinone

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High thebaine poppy and methods of producing the same
  • High thebaine poppy and methods of producing the same
  • High thebaine poppy and methods of producing the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0197] Referring to Figure 2, the inventors used single hairpin constructs targeting the genes encoding the CODM and T6ODM enzymes to test the hypothesis that plants containing high levels of thebaine (codeine and morphine reduced levels) plants can be produced by simultaneously reducing the activity of T6ODM and CODM enzymes.

[0198] Reference attached image 3 , the coding sequences of CODM and T6ODM genes share a very high level of identity. Therefore, the inventors created a single expression construct to target by RNAi the endogenous gene encoding CODM and the endogenous gene encoding T6ODM from a portion of the T6ODM coding sequence. Portions of the T6ODM coding sequence of the sense and antisense portions of the RNAi gene construct described in Figure 2 are in image 3 are underlined. A 342 base pair sense fragment was amplified from cDNA isolated from poppy plant material using primers AAAGGCGCGCCCCTTGTCCTCAACCAAATAAAATTTAAATTCCACTTTTAAACAAAGC). A 342 base pair an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the production of opium poppy plants having high levels of thebaine. More particularly, the disclosure relates to the production of opium poppies having high levels of thebaine by simultaneously reducing the expression of genes encoding thebaine 6-0- demethylase (T60DM) and codeine 3-0-demethylase (CODM).

Description

technical field [0001] The present disclosure relates to the production of opium poppy with high levels of thebaine. More specifically, the present disclosure relates to the production of thebaine with high levels by simultaneously reducing the expression / activity of thebaine 6-O-demethylase (T6ODM) and codeine 3-O-demethylase (CODM). Because of the poppy. Background technique [0002] Opioids are psychoactive substances derived from the poppy (Papaver somniferum) or its synthetic analogues. Opioids have the potential to cause substance dependence, characterized by a strong need to take opioids, difficulty controlling opioid use, persistent opioid use despite harmfulness, opioid use taking precedence over other activities and obligations, tolerance Increased receptivity and the body's withdrawal response when opioids are discontinued. [0003] As of 2014, an estimated 17 million people were living with opioid dependence (ie opioid addiction). Most people who are dependen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01H1/00C12N15/53C12N15/82C12N5/10C12N9/02C12P17/18A61K31/485A61P25/04C08L7/02A01H6/64
CPCA61K31/485C12N9/0071C12P17/18A61P25/04C12N15/8218C12N15/8243C12Y114/11031C12Y114/11032C12N15/8216C12N15/8257
Inventor 伊戈尔·科瓦楚克
Owner API LABS INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com