A polypeptide capable of alleviating morphine tolerance and side effects and its application

A technology for morphine tolerance and side effects, applied in the field of medicine, can solve problems such as limiting the clinical application of morphine, and achieve the effect of alleviating the symptoms of morphine tolerance and side effects

Active Publication Date: 2020-09-01
XUZHOU MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the severe drug tolerance caused by long-term medication largely limits the clinical application of morphine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A polypeptide capable of alleviating morphine tolerance and side effects and its application
  • A polypeptide capable of alleviating morphine tolerance and side effects and its application
  • A polypeptide capable of alleviating morphine tolerance and side effects and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Obtaining of Polypeptide TAT-μ1

[0030] (1) TAT-μ1 polypeptide with membrane penetrating activity obtained

[0031] The total RNA of SH-SY5Y cells was extracted, reverse-transcribed to obtain cDNA, and the mu opioid receptor carboxy-terminal polypeptide sequence was obtained by PCR using the cDNA as a template. The upstream primer: 5'CCATCTCGAGATGTACGGTCGTAAAAAACGTCGTCAGCGTCGTCGTAT CCCAACCTCTTCCAACATTG3'(SEQ ID NO.7), the downstream primer 5 'CGTCGGATCCGGGCAACGGAGCAGTTTCTG 3' (SEQ ID NO.8) (bold is the penetrating peptide sequence), insert the TAT coding sequence into the upstream primer, add XhoI and BamHI restriction sites to the upstream and downstream primers respectively, and link by restriction enzyme , construct pWaldo-TAT-μ1 Escherichia coli expression vector, and transform BL21(DE3) expression strain to obtain recombinant.

[0032] Inoculate the BL21(DE3) recombinant strain in 200ml LB medium and culture overnight at 37°C. Transfer 50ml overnight c...

Embodiment 2

[0039] Example 2 Application Research of Polypeptide TAT-μ1

[0040] Frozen section preparation: ①The mice in each experimental group were anesthetized with 10% chloral hydrate (350mg / kg, i.p.), opened their thoracotomy, and quickly perfused the left ventricle with 150ml normal saline (adjusted to 37°C in advance), followed by perfusion with 4% paraformaldehyde phosphate 500ml of salt buffer solution (pre-cooled to 0°C-4°C), the perfusion should be completed within 1 hour. After the perfusion, the brain was removed and fixed in 4% paraformaldehyde solution at 4°C for 8 hours. ②Put the fixed brains in 20% and 30% sucrose phosphate buffer in sequence, dehydrate in gradient, and soak until the tissue sinks to the bottom of the bottle, so as to avoid the formation of ice crystals during rapid freezing and improve the quality of sectioning. ③Slice with a cryostat, each slice is 25 μm. ④ Wash the slices with 10mM PBS 3 times, 5min each time, seal the slices, and take pictures to d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a polypeptide with a morphine tolerance and side effect relieving function and an application of the polypeptide. The polypeptide is named as TAT-mu1 and as shown in following(1) or (2): (1) a polypeptide of a (12-58) amino acid residue of an amino acid sequence as shown in SEQ ID NO:1; (2) a polypeptide of an amino acid sequence as shown in SEQ ID NO:1. The polypeptide TAT-mu1 comes from a mu opioid receptor carboxyl terminal, the TAT-mu1 and the mu opioid receptor carboxyl terminal can be competitively phosphorylated by G protein-coupled receptor kinase when morphine acts on a mu opioid receptor, the phosphorylated TAT-mu1 can be combined with beta-arrestin2, and interaction of the mu opioid receptor and the beta-arrestin2 is interfered, so that beta-arrestin2 mediated morphine tolerance and side effect symptoms are relieved. The polypeptide TAT-mu1 has clinical application potential in prevention and treatment of morphine tolerance, side effects and thelike.

Description

technical field [0001] The invention relates to the technical field of medicine, in particular to a polypeptide capable of alleviating morphine tolerance and side effects and its application. Background technique [0002] Morphine is currently one of the most clinically effective drugs for rapidly relieving various types of pain, especially for severe pain and cancer pain. However, severe drug tolerance caused by long-term medication largely limits the clinical application of morphine. Morphine analgesia is mainly mediated through μ opioid receptors (μopioid receptor: MOR), and the process involves GTP-binding protein (G protein for short), GRKs (GPCR kinases) and β-arrestin2 and other proteins. After knocking out the β-arrestin2 gene in mice, the MOR desensitization and drug tolerance caused by morphine disappeared, not only the side effects such as respiratory depression and constipation caused by morphine were also significantly improved, and its overexpression can weake...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/705C12N15/12C12N15/70C12N1/21A61K38/17A61P1/10A61P11/16
CPCA61K38/00A61P1/10A61P11/16C07K14/705C12N15/70
Inventor王中山张梦
OwnerXUZHOU MEDICAL UNIV