A kind of polypeptide with anticancer effect and its application
A technique of action, colon cancer, applied in the field of medicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Polypeptide TAT-ET A 1's get
[0037] (1) TAT-ET with transmembrane activity A 1 peptide obtained
[0038] Total RNA was extracted from SKOV3 cells, cDNA was obtained by reverse transcription, and ET was obtained by PCR using cDNA as a template A R carboxy-terminal polypeptide sequence, its upstream primer: Downstream primer 5'CGTCGGATCCGTTCATGCTGTCCTTATGGCT3'(SEQ ID NO.8) (penetrating peptide sequence in bold), insert TAT coding sequence into the upstream primer, add XhoI and BamHI restriction sites to the upstream and downstream primers respectively, link by restriction enzyme digestion method to construct pWaldo-TAT-ET A 1 Escherichia coli expression vector, and transformed into BL21 (DE3) expression strain to obtain the recombinant.
[0039] Inoculate the BL21(DE3) recombinant strain in 200ml LB medium and culture overnight at 37°C. Transfer 50ml overnight culture to 1L LB medium, culture to OD at 37℃ 600 Between about 0.5 and 0.6, add IPTG wit...
Embodiment 2
[0046] Example 2 Polypeptide TAT-ET A 1 Inhibition of migration and invasion of ovarian cancer cells
[0047] Cell migration and invasion: SKOV3 cell migration and invasion assays use a 24-well transwell cell culture chamber, and a polycarbonate filter membrane with 8 μm pores is placed in the chamber. Digest the cultured cells with trypsin (add 0.2 mg / mL TAT-ET before digestion A 1 polypeptide was treated for 2h) and resuspended in RPMI-1640 medium to make the final concentration 2×10 5 pieces / ml. 500 μL of 10% FBS / RPMI-1640 medium or 500 μL of SDF-1 solution was added to the bottom layer of the chamber, and 100 μL of cell suspension was added to the upper layer of the filter membrane.
[0048] For the invasion experiment, 50 μL of Matrigel gel diluted 1:1 in serum-free RPMI-1640 medium was spread in the Transwell chamber, and 400 μL of cell suspension was inoculated after incubation at 37°C for 2 hours.
[0049] After standing in a constant temperature incubator for 24 h...
Embodiment 3
[0053] Example 3 Polypeptide TAT-ET A 1 Inhibition of migration and invasion of colon cancer cells
[0054] Cell migration and invasion: The HCT8 cell migration and invasion assay uses a 24-well transwell cell culture chamber, and a polycarbonate filter membrane with 8 μm pores is placed in the chamber. Digest the cultured cells with trypsin (add 0.2 mg / mL TAT-ET before digestion A 1 polypeptide was treated for 2h) and resuspended in RPMI-1640 medium to make the final concentration 2×10 5 pieces / ml. 500 μL of 10% FBS / RPMI-1640 medium or 500 μL of SDF-1 solution was added to the bottom layer of the chamber, and 100 μL of cell suspension was added to the upper layer of the filter membrane.
[0055] For the invasion experiment, 50 μL of Matrigel gel diluted 1:1 in serum-free RPMI-1640 medium was spread in the Transwell chamber, and 400 μL of cell suspension was inoculated after incubation at 37°C for 2 hours.
[0056] After standing in a constant temperature incubator for 24 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



