Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusarium oxysporum tor gene RNAi carrier and method for combined control of potato dry rot and wilt with salicylic acid

A technology of Fusarium oxysporum and potato drying, applied in the fields of molecular biology and plant disease control, to achieve the effects of weakening pathogenicity, reducing plant wilt and dry rot, and reducing the use

Active Publication Date: 2021-03-02
INST OF URBAN AGRI CHINESE ACADEMY OF AGRI SCI +1
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it has not been reported whether salicylic acid directly enters the pathogenic bacteria and kills the pathogenic bacteria by inhibiting the activity of key target proteins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusarium oxysporum tor gene RNAi carrier and method for combined control of potato dry rot and wilt with salicylic acid
  • Fusarium oxysporum tor gene RNAi carrier and method for combined control of potato dry rot and wilt with salicylic acid
  • Fusarium oxysporum tor gene RNAi carrier and method for combined control of potato dry rot and wilt with salicylic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1, plant hormone salicylic acid (SA) inhibits the hyphal growth and pathogenicity of Fusarium oxysporum 1. Process Fusarium oxysporum on a plate with different concentrations of SA

[0022] Prepare PDA plates with different concentrations of SA of 0.5mmol / L, 1mmol / L, 5mmol / L, 10mmol / L, and 15mmol / L under sterile conditions. PDA medium was placed in the middle of the plate. After sealing, they were cultured in a fungal incubator at 25°C, and each treatment was replicated at least three times. After cultivating Fusarium oxysporum for 5 days, observe and count the diameter of fungal hyphae; at the same time, observe the mycelial morphology of Fusarium oxysporum after cultivating for 5 days under a scanning electron microscope, and the results are as follows: figure 1 Shown in B. According to the experimental results, it was found that with the increase of SA concentration, the mycelial growth was more and more inhibited, indicating that SA inhibited the growth...

Embodiment 2

[0025] Example 2. Study on the pathogenicity of Fusarium oxysporum to potato after silencing the FoTOR gene of Fusarium oxysporum by siRNAs

[0026] 1. Design and synthesis of siRNAs against FoTOR

[0027] Using the yeast TOR protein as a reference to search the genome database of Fusarium oxysporum, it was found that Fusarium oxysporum contains two TOR genes, and their full-length CDS sequences are FoTOR1:7329bp; FoTOR2:5277bp. For the CDS sequence of FoTOR, the following siRNAs were designed and synthesized using siRNA design software. siRNA1: CCTTACAAACACCAGGTAATT (Seq ID No: 6); siRNA2: GCAAGATCCTGCTCAACATTT (Seq ID No: 7); siRNA3: GAGGTGGCGATGAAGAGAGTT (Seq ID No: 8); Negative control (Negative control, NC): TTCTCCGAACGTGTCACGTTT (Seq ID No: 9). siRNAs were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.

[0028] 2. siRNAs inoculation experiment

[0029] The synthetic siRNAs were mixed with the spore suspension of Fusarium oxysporum to inoculate potato leaves a...

Embodiment 3

[0030] Embodiment 3, Fusarium oxysporum TOR gene RNAi expression vector construction

[0031] The CDS sequences of FoTOR1 and FoTOR2 of Fusarium oxysporum were homologously compared in NCBI to find out the most suitable sequence for constructing RNAi interference vector, and the RNAi interference sequences of FoTOR1 and FoTOR2 were combined and named FoTOR12. The sequence of FoTOR12 is Seq ID No: 1 (the one without underline is FoTOR1, and the one with underline is FoTOR2):

[0032] CGATCCAGGAGAGACTACTTGATATGCTCAGCGTAGTTCTCTGCGGTGAGCCATTTAAACCCCTTGGCGCTCCACAACCAAATACTCTCAGCTCAGTCCCGATTATTCCCAAAGACGCAAAAGACCCCCACGCTTATGAGCACCGAAGGGCTGAGGTCAAGTTGGCGCTCAACACTCTCGGTAGTTTCGATTTCTCAGGACATGTTCTGAACGAGTTTGTTCGAGACGTCGCAATCAAGTACGTTGAAGACGAGGATCCAGAAATCCGTGAGGCAGCGGCCTTGACATGCTGCCAATTAT CACCACGCGGCTGTGATTGAAGCTATTATGAACATCTTCCGCACCCTGGGCTTGGAGTGTGTTTCGTTCCTT GATAGAATCATACCGGCATTCCTCCAGGTGATACGATCGGCCACTTCCACGAGACCCGAGTCTTACTTCAACCAAC TGGCCACTCTCGTCAGCATCGTGCGGCAACATATAAGAAATTATCTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Fusarium oxysporum TOR gene RNAi vector, which uses the plant expression vector pEarleyGate 303 as a backbone vector and inserts the sequence shown in Seq ID No: 3 at the recombination site. A microbial transformant containing the aforementioned RNAi vector is also disclosed. It also discloses the application of the aforementioned RNAi vector in preventing and treating potato dry rot and fusarium wilt. Also disclosed is a method for combined prevention and treatment of potato dry rot and wilt: the aforementioned RNAi vector is transferred into potatoes to obtain transgenic potatoes, and the transgenic potatoes are treated with salicylic acid to prevent dry rot and wilt. The present invention successfully constructs the Fusarium oxysporum RNAi interference vector, and the combined use of the plant hormone salicylic acid and the FoTOR12-RNAi transgene can significantly weaken the pathogenicity of Fusarium oxysporum. disease and dry rot provides an effective method.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and plant disease prevention and control, in particular to a Fusarium oxysporum TOR gene RNAi carrier and a method for controlling potato dry rot and wilt in combination with salicylic acid. Background technique [0002] Potato belongs to the herbaceous plant of Solanaceae, and its tubers are edible. It is the fourth most important food crop in the world after wheat, rice and corn. As an important potato producing country in the world, China has always ranked first in the world in terms of potato planting area and total output. It is estimated that by 2020, China's potato planting area will expand to more than 100 million mu, the average yield per mu will increase to 1300 kg, and the total output will reach 1.3 Therefore, the development of my country's potato industry will inevitably have an important impact on the world's potato industry. In 2015, the Ministry of Agriculture proposed ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/113A01H6/82A01N37/40A01P3/00
CPCA01N37/40C12N15/113C12N15/8218C12N15/8282C12N2310/14
Inventor 任茂智李林宣祝婷婷李付广
Owner INST OF URBAN AGRI CHINESE ACADEMY OF AGRI SCI