Kit and detection method for detecting EGFR gene T790M mutation
A technology of T790M-F and T790M-R is applied in the field of kits for detecting EGFR gene T790M mutation, which can solve the problems of long detection time, complicated procedures and high detection cost, and achieve the effect of reducing detection time and cost.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2019-12-27
- Estimated Expiration
- Not applicable · inactive patent
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention relates to the technical field of gene detection, in particular to a kit for detecting EGFR gene T790M mutation. Background technique
[0002] At present, the T790M mutation on exon 20 is the most common gene mutation. Therefore, the third-generation TKI, represented by Osimertinib, has emerged for this mutation, and the detection of T790M mutation is becoming more and more popular. There is an urgent need for a simple and rapid method for detecting the T790M mutation.
[0003] At present, there are several diagnostic platforms based on PCR detection for EGFR mutation detection, including cobas method, ARMS method, BEAMing method, digital PCR method, HRM method, DHPLC method, mass spectrometry genotyping, electric field induced release and measurement method (EFIRM) and next-generation sequencing (NGS).
[0004] The rapid detection of nucleic acid data with high sensitivity and single base specificity is helpful for the detection of var...
Examples
Embodiment 1
[0055] This embodiment provides a kit for detecting the T790M mutation of the EGFR gene, including an isothermal amplification reaction system, a detection reaction system, and a ctDNA standard product with known T790M mutation frequency of the EGFR gene.
[0056] The isothermal amplification reaction system comprises:
[0057] The isothermal amplification reaction system includes: T790M site detection primers, Rehydration Buffer, MgA C and RPA lyophilized enzyme;
[0058] Wherein, the T790M site detection primers include primer T790M-F and primer T790M-R:
[0059] The base sequence of the primer T790M-F is as follows:
[0060] GAAATTAATACGACTCACTATAGGGCATCTGCCTCACCTCCACCGTGCAGCTCATC.
[0061] The base sequence of the primer T790M-R is as follows:
[0062] TTCCCGGACATAGTCCAGGAGGCAGCCGAAGGGC.
[0063] The detection reaction system includes: Cas13a Enzyme Mix, detection mutant probe, dNTP Mix, T7 RNAPolymerase Mix and MgCl 2 .
[0064] The detection mutant probe is T790MP...
Embodiment 2
[0082] This embodiment provides a kit for detecting the T790M mutation of the EGFR gene, including an isothermal amplification reaction system, a detection reaction system, and a ctDNA standard product with known T790M mutation frequency of the EGFR gene.
[0083] T790M site detection primer, Rehydration Buffer, MgA C and RPA lyophilized enzyme;
[0084] Wherein, the T790M site detection primers include primer T790M-F and primer T790M-R:
[0085] The base sequence of the primer T790M-F is as follows:
[0086] GAAATTAATACGACTCACTATAGGGCATCTGCCTCACCTCCACCGTGCAGCTCATC.
[0087] The base sequence of the primer T790M-R is as follows:
[0088] TTCCCGGACATAGTCCAGGAGGCAGCCGAAGGGC.
[0089] The detection reaction system includes: Cas13a Enzyme Mix, detection mutant probe, dNTP Mix, T7 RNAPolymerase Mix and MgCl 2 .
[0090] The detection mutant probe is T790MProbe, and the base sequence of the T790MProbe is:
[0091] TAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACGCATCA...