Group B epidemic cerebrospinal meningitis fHbp-V3 recombinant protein, preparation method thereof, vaccine composition and application thereof
A vaccine composition, fhbp-v3 technology, applied in botany equipment and methods, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problems of low immunogenicity and inability to be used in the research of group B meningococcal vaccine , to achieve a remarkable effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The construction of embodiment 1.fHbp-V3 prokaryotic expression plasmid
[0035] 1.1. Obtain gene sequence
[0036] The nucleotide sequence of the fHbp-V3 gene as shown in seq ID NO.2 was obtained from the subvariant V3.94 strain of the fHbp gene of group B meningococcal meningitis preserved by the China Center for Disease Control and Prevention through conventional PCR gene amplification, The PCR primers used for amplification were: upstream primer: TGACCTGCCTCATTGATGC, downstream primer: GCCGTCCGAACACGATAATTTACCG, PCR conditions were pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30s; annealing at 60°C for 30s; extension at 72°C for 60s; 30 cycles; 72°C After extension for 5min;
[0037] 1.2 Codon optimization:
[0038] In order to better express the target protein, remove the signal peptide nucleotide sequence of the fHbp gene shown in seq ID.NO.2 and use lasergene software to optimize the codon preference synthesis of E. coli to obtain the nucleo...
Embodiment 2
[0053] The establishment of embodiment 2.fHbp-V3 prokaryotic expression strain
[0054] The fHbp-V3 prokaryotic expression plasmid with correct sequencing was transformed into BL21(DE3) competent cells, spread on the LB solid medium containing kanamycin resistance, and picked the colony into a test tube containing 5ml liquid LB medium, 37 Cultivate on a shaker with a rotation speed of 180rpm until the OD value of the bacterial solution reaches 0.2-0.4, add 5 μL of IPTG (isopropyl-β-D-thiogalactoside) to induce expression, and collect the bacteria at 12000rpm after 3 hours of induction , resuspended with PBS solution and run SDS-PAGE protein electrophoresis to identify the expression of bacterial protein. image 3 Shown is the expression of fHbp-V3 prokaryotic expression protein strain.
Embodiment 3
[0055] Expression and purification of embodiment 3.fHbp-V3 recombinant protein
[0056] 3.1. Expression of fHbp-V3 recombinant protein
[0057] 1) Inoculate 50 μL of fHbp-V3 prokaryotic expression bacterial solution with high expression level into a test tube containing 10 mL of liquid LB medium, cultivate overnight at 37°C on a shaker with a rotation speed of 180 rpm, and inoculate into 2L of liquid LB culture medium the next morning cultured in cultured flasks.
[0058] 2) When the OD value of the bacterial solution reaches 0.2-0.4, add 2 mL of IPTG to induce expression, and express for 20 hours at 16° C. on a shaker with a rotation speed of 180 rpm.
[0059] 3) The bacterial solution was centrifuged at 8000rpm for 30min, the bacterial cells were collected, and the bacterial cells were resuspended with 200mL of Tris solution with a pH of 7.5 and 30mM / L to form a bacterial cell suspension.
[0060] 4) Use a high-pressure homogenizer to crush the bacteria, the crushing condi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More