Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel application of human CD133 protein 1-108 peptide fragment

A protein and peptide technology, applied in the field of biomedicine, can solve problems such as unrelated research reports, and achieve the effect of great application value and prospects

Active Publication Date: 2020-08-14
KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology explains that it can kill brain cancer by targeting specific molecules called gltlumate-related protein 4 (GLT) or glutathione peroxidase-4 (GPX4). These proteins are involved in regulating various aspects of neuronal function such as growth control during developmental processes like embryogenesis. They also help distinguish different types of neurologically active cells from normal ones based on their ability to produce these substances. By combining this therapy with Temodar® for example, we aimed at developing new treatments against brain cancer.

Problems solved by technology

This patents discusses two types of glioblasmatoid nerve growth factor (Gliocytoma), labeled together called glioma associated antigens or glucanoma related polysachromexons (GLY). These glioma derived peptoids were identified based upon their ability to bind specifically to certain targets like CD 133 and act as putative target candidates for therapy purposes due to their unique properties. However, these glioma-associating carcinogenic agents also exist along with other forms of mesothelium-related transporters. Therefore, studying glioma stems cells could help identify new drugs useful against glioma disease without causing side effects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel application of human CD133 protein 1-108 peptide fragment
  • Novel application of human CD133 protein 1-108 peptide fragment
  • Novel application of human CD133 protein 1-108 peptide fragment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1: pathophysiological detection

[0054] The glioblastoma chip entrusted Shanghai Xinchao Company to carry out immunohistochemical experiments to analyze the correlation between the expression of GLT8D1 and the clinical grade of glioma patients; perform HE staining experiments on tumor tissues taken out of experimental animals;

[0055] The immunohistochemical staining experiment was as follows: fix the tissue to be tested overnight with 4% PFA, rinse the fixed tissue block with running water for 30 minutes; 75% ethanol for 1 hour; 80% ethanol for 1 hour; 90% ethanol for 1 hour; 95% ethanol I for 1 hour; Ⅱ 1h; 100% ethanol Ⅰ 1h; 100% ethanol Ⅱ 1h; xylene Ⅰ 35min; xylene Ⅱ 35min; immersion in paraffin: paraffin Ⅰ 1h; Slice with a thickness of 3 μm, select complete and flat slices, spread them in hot water at 56°C, and dry at 65°C for 30 minutes; then perform dyeing operations: 3 cylinders of xylene, 10 minutes each; 2 cylinders of absolute ethanol, 2 minutes e...

Embodiment 2

[0058] Example 2: Effect of human GLT8D1 knockdown or overexpression on the formation of glioma cell clone spheres

[0059] 1. Construction of GLT8D1 stably knocked down or overexpressed cell lines

[0060] Utilize the lentiviral gene overexpression vector pCDH-MSCV-eGFP-3×Flag to construct the GLT8D1 overexpression vector, design PCR primers to amplify the coding region sequence of the human GLT8D1 gene, and clone it into the above overexpression vector, the PCR primer is F: ATGTCATTCCGTAAAGTAAAC, R: TCACTTTATGTTTGAGATCTC, negative control is pCDH-MSCV-eGFP-3×Flag; use pLKO.1shRNA expression vector, design shRNA target sequence according to human GLT8D1 gene sequence, synthesize 2 pairs of oligonucleotide sequences, and synthesize control oligonucleotide Nucleotide sequence, the above oligonucleotide sequence was coupled and cloned into the pLKO.1 vector, the negative control scramble shRNA sequence was: GCACTACCAGAGCTAACTCAG; the 21bp shRNA targeting GLT8D1 sequences were: s...

Embodiment 3

[0070] Example 3: Western blot detection experiment of glioma stem cell markers in GLT8D1 knockdown or overexpression cells

[0071] After the cells were treated according to the specific experiment, the supernatant medium was discarded, and washed once with PBS; the corresponding cell lysate was added according to the amount of the cell pellet, and the cells were repeatedly frozen and thawed on ice for 3 times, and pipetting was continued during the period; 4°C , Centrifuge at 15000rpm / min for 10min, take the supernatant and discard the precipitate for subsequent experiments. After the BCA protein is quantified, add 5× loading buffer, boil in a metal dry heat apparatus at 100°C for 5 minutes; directly perform polyacrylamide gel (SDS-PAGE) electrophoresis, or take it out and put it on ice to cool and subpackage. Store at -80°C. Add 30-50 μg of protein to each well, first run the stacking gel by electrophoresis at 80V voltage, and then run electrophoresis at 120V voltage until...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel application of a human CD133 protein 1-108 peptide fragment (FECD133), namely an application of FECD133 in preparation of a medicine for inhibiting CD133 positive tumors and an application of FECD133 in preparation of a medicine for treating treatment gliomas; the human FECD133 peptide fragment is applied to temozolomide chemotherapy for treating glioma as an intensive chemotherapy drug, wherein the amino acid sequence of the human FECD133 is shown as SEQ ID NO: 1. The high-expression GLT8D1 can glycosylate and stabilize a marker CD133 of the glioma stem cell and activate a Wnt/beta-catenin signal path, so that the activity of the glioma stem cell is promoted, while the FECD133 can obviously block the interaction of the GLT8D1 and the CD133, thereby inhibiting the onset and progression of tumors; and more importantly, the FECD133 is combined with the glioma clinical chemotherapeutic drug temozolomide, so that the killing effect on tumor cells can be enhanced.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com