Unlock instant, AI-driven research and patent intelligence for your innovation.

Cabbage type rape male sterility gene, protein, vector, engineering bacterium and application of cabbage type rape male sterility gene

A technology for male sterility gene and Brassica napus, which can be used in genetic engineering, application, plant genetic improvement and other directions, and can solve problems such as pollen production

Active Publication Date: 2020-12-29
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, neither BnMS5 b Or BnMS5 d The resulting male sterility of rapeseed is affected by temperature, and pollen is produced under low temperature conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cabbage type rape male sterility gene, protein, vector, engineering bacterium and application of cabbage type rape male sterility gene
  • Cabbage type rape male sterility gene, protein, vector, engineering bacterium and application of cabbage type rape male sterility gene
  • Cabbage type rape male sterility gene, protein, vector, engineering bacterium and application of cabbage type rape male sterility gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Analysis on Genetic Rule of Nuclear Dominant Sterile Material of Brassica napus

[0031] 1. Experimental materials

[0032] The sterile line is called E2A and the fertile line is called E2B. EMS mutagenesis was carried out on Brassica napus inbred line TE5 to obtain a sterile single plant E2A (the sterile plant is called E2A, and the fertile plant is called E2B), and the sterile single plant was crossed with Zhongshuang 11, And use Zhongshuang 11 as the recurrent parent to backcross to obtain near isogenic lines. with BnMS5 b and BnMS5 d Rapeseed male sterility caused by the gene is affected differently by temperature. After different temperature treatments in the flowering stage of rapeseed, the fertility of the single sterile E2A plant is not affected by temperature. The sterile plant E2A had poor fruiting under the condition of artificial assisted pollination or natural pollination, basically no fruiting ( figure 1 , the seed setting of Brassica napus E2B and E2...

Embodiment 2

[0038] Brassica napus Dominant Nuclear Sterility Gene BnMS5 f with BnMS5 d Allelic analysis of

[0039] Zeng et al. (Xinhua Zeng, Wenpin Li, Yuhua Wu, Fang Liu, Junling Luo, Yinglong Cao, Li Zhu, Yunjing Li, Jun Li, Qingbo You, Gang Wu. Fine mapping of a dominantthermo-sensitive genic male sterility gene (BntsMs) in rapeseed (Brassicanapus) with AFLP-and Brassica rapa-derived PCR markers.Theor Appl Genet.2014,127:1733–1740) found a thermosensitive nuclear male sterile line TE5A in Brassica napus, and cloned it using map-based cloning sterile gene BnMS5 d . To verify whether the E2A sterility gene is related to BnMS5 d Gene allele, the present invention utilizes homozygous E2A sterile line and fertile homozygous TE5A under low temperature conditions (genotype is BnMS5 d BnMS5 d ) to get F 1 . Will F 1 Planted in the greenhouse, keep a stable temperature of 25°C during the flowering period, and observe the F 1 Plant fertility, F 1 All showed complete infertility. Use...

Embodiment 3

[0043] Brassica napus Dominant Nuclear Sterile Gene BnMS5 f functional verification of

[0044] 1. BnMS5 f Rapeseed Transgenic Experiment

[0045] In this example, the plant expression vector pCAMBIA2300 was used as the transgenic vector of Brassica napus. The vector encodes a bacterial origin of replication (ori), a kanamycin resistance gene (Kan'), a CaMV35S promoter, a terminator for the NOS gene, and a restriction enzyme multiple cloning site. By analyzing the relationship between the restriction site of the BAC clone sequence carrying the candidate gene and the candidate gene, it was amplified using primers ZT-1L, ZT-1R and high-fidelity PCR technology (PhusionTM High-Fidelity DNAPolymerse, from New England Biolads Company) A 3.951kb fragment,

[0046] ZT-1L (forward primer): CCGGAATTCCTATTAATAAATTAATGACTCAGCT (SEQ ID NO.5);

[0047] ZT-1R (reverse primer): CAACTGCAGCCAAGAAGAGAATTGATTCCACA (SEQ ID NO. 6).

[0048] This fragment contains Ecol I and Pst I restriction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a cabbage type rape male sterility gene BnMS5f, a protein, a carrier, engineering bacteria and an application of the cabbage type rape male sterility gene. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1. The gene BnMS5f disclosed by the invention can be used as a functional gene for rape male gamete development regulation and control to be applied to creation of a rape genetic engineering male sterility system.

Description

technical field [0001] The invention relates to the technical field of biological breeding, in particular to a male sterility gene BnMS5 of Brassica napus f , protein, carrier, engineering bacteria and their applications. Background technique [0002] At present, the male sterility systems used in rapeseed heterosis in my country are mainly cytoplasmic male sterile system and nuclear male sterile system, but the application of cytoplasmic male sterile system in rapeseed production has some unsatisfactory aspects. However, the sterility of the nuclear male sterility system is stable and complete, and there is no potential risk of sterile cytoplasmic negative effects and cytoplasmic simplification. It is generally not limited by the restoration relationship, and it is easy to obtain strong dominant combinations. In the use of heterosis Has broad prospects. In recent years, my country has continuously made breakthroughs in the field of rapeseed male sterility research. The de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H5/02A01H6/20
CPCC07K14/415C12N15/8289
Inventor 曾新华吴刚闫晓红袁荣王淼刘芳罗军玲武玉花朱莉李晓飞李均
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI