Hippocampus oxytocin AVT and IT and application thereof in preparation of oxytocin
A technology of oxytocin and hippocampus, applied in the fields of biochemistry and molecular biology, can solve the problems of male parenting, sex role reversal and the unclear regulation mechanism of mating forms diversification, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] In this study, we cloned and identified the full-length cDNA sequences of the arginine oxytocin AVT and oxytocin IT genes in the striated hippocampus. Based on the hippocampal transcriptome data, we designed primers for the intermediate fragment. The intermediate fragment was cloned in the hippocampal brain, and then sequenced to obtain the intermediate fragment. The 5'UTR and 3'UTR regions of AVT and IT were obtained by Smart-RACE, and the full-length cDNA sequence of the AVT gene was identified as 675bp, the open reading frame (ORF frame) was 477bp, and the nucleotide sequence was as shown in SEQ ID NO.1所示(atggctcgctcctccgcgttaccccggtgcgtgctgggactcctcgccctctccatcgccctctcctccgcctgctacatccagaactgcccccggggaggcaagcgagccttggccgagacggcactcagacagtgcatgtcatgcggccccggggaaaaaggccgctgctacggcccaaacatctgctgcgtggagggcttcggctgccttctaggctcctcggaaacaactcaatgtgtggaggagaactacctgctgactccctgccaggccggggggcgaccctgcggactggaggggggtcgctgcgccgcttcaggactctgctgtaactctgagagctgtgcagtggactcctcctgtctgg...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


