Unlock instant, AI-driven research and patent intelligence for your innovation.

Hippocampus oxytocin AVT and IT and application thereof in preparation of oxytocin

A technology of oxytocin and hippocampus, applied in the fields of biochemistry and molecular biology, can solve the problems of male parenting, sex role reversal and the unclear regulation mechanism of mating forms diversification, etc.

Pending Publication Date: 2022-07-12
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of these studies have focused on economic fish, but the regulation mechanism of this unique reproductive behav

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hippocampus oxytocin AVT and IT and application thereof in preparation of oxytocin
  • Hippocampus oxytocin AVT and IT and application thereof in preparation of oxytocin
  • Hippocampus oxytocin AVT and IT and application thereof in preparation of oxytocin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] In this study, we cloned and identified the full-length cDNA sequences of the arginine oxytocin AVT and oxytocin IT genes in the striated hippocampus. Based on the hippocampal transcriptome data, we designed primers for the intermediate fragment. The intermediate fragment was cloned in the hippocampal brain, and then sequenced to obtain the intermediate fragment. The 5'UTR and 3'UTR regions of AVT and IT were obtained by Smart-RACE, and the full-length cDNA sequence of the AVT gene was identified as 675bp, the open reading frame (ORF frame) was 477bp, and the nucleotide sequence was as shown in SEQ ID NO.1所示(atggctcgctcctccgcgttaccccggtgcgtgctgggactcctcgccctctccatcgccctctcctccgcctgctacatccagaactgcccccggggaggcaagcgagccttggccgagacggcactcagacagtgcatgtcatgcggccccggggaaaaaggccgctgctacggcccaaacatctgctgcgtggagggcttcggctgccttctaggctcctcggaaacaactcaatgtgtggaggagaactacctgctgactccctgccaggccggggggcgaccctgcggactggaggggggtcgctgcgccgcttcaggactctgctgtaactctgagagctgtgcagtggactcctcctgtctgg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses hippocampus oxytocin AVT and IT and application of the hippocampus oxytocin AVT and IT in preparation of an oxytocic agent. The amino acid sequence of the hippocampus oxytocin AVT is as shown in SEQ ID NO. 2. And the amino acid sequence of the hippocampus oxytocin IT is as shown in SEQ ID NO. 4. The hippocampus oxytocin AVT and IT with the spawning induction function are separated from the hippocampus and can be used for hippocampus delivery to adjust the spawning induction behavior of the hippocampus.

Description

Technical field: [0001] The invention belongs to the field of biochemistry and molecular biology, and specifically relates to hippocampal oxytocin AVT and IT and their application in the preparation of oxytocin. Background technique: [0002] Sea dragons have received extensive attention because of their unique adaptations. As early as 1867, Lockwood discovered that seahorses reproduce offspring through pouches, but the physiological mechanism of this phenomenon could not be explained (Lockwood, 1867). With the development of teleost research methods, the regulatory mechanism of fish reproduction has been gradually uncovered, including gonadal differentiation, gametogenesis and reproductive behavior characteristics (Lubzens et al., 2010; Munakata and Kobayashi, 2010; Zohar et al. , 2010). Most of these studies have focused on economic fish, and the regulatory mechanisms of this unique reproductive behavior in Hyenadonids, including male parenting, sexual role reversal, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/46C07K7/16A61K38/095A61K38/17A61P15/04
CPCC07K14/461C07K7/16A61K38/095A61K38/1706A61P15/04Y02A40/81
Inventor 张辉贤林强刘雅莉秦耿张艳红
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI