Novel peptide ligands of leukocyte integrins
A technology for integrin and leukocytes, applied to peptide/protein components, medical preparations containing active ingredients, peptides, etc., can solve problems that hinder the modeling of small molecule inhibitors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1, phage display
[0054] Alpha was purified from buffy coats obtained from the Finnish Red Cross Blood Transfusion Service by antibody affinity chromatography as previously described. M beta 2 Integrin (Li et al., 1995), Integrin Tris-buffered saline / 1 mM MnCl 2 After dilution, the microtiter wells were coated and left overnight at 4°C, with 1 μg per well for the first biopanning, and 100ng, 10ng, and 1ng for subsequent pannings, respectively. The sample wells were blocked with TBS containing 5% BSA at 22° C. for 1 hour, and then washed five times with TBS. Basically use CX in the same way as previously described 7 C and CX 9 C phage peptide libraries were biopanned (Koivunen et al., 1994). We modified the library construct to convert single-stranded DNA encoding degenerate sequences to double-stranded by 5 cycles of PCR using only the reverse primer followed by 11 cycles using both forward and reverse primers form. A total of 6 μg of double-stranded ...
Embodiment 2
[0072] Embodiment 2, integrin binding experiment
[0073] Preparation of GST and Fc fusion protein
[0074] The nucleotide sequence encoding LLG-C4 was obtained by containing a BamHI site (5' AGGCTCGAGGATCCTCGGCC
[0075] GACGGGGCT3') and EcoRI site (5'AGGTCTAGAATTCGCCCCAGCGGCCCC3') primers were obtained by PCR amplification of phage DNA. The PCR product was purified on an agarose gel and digested with two restriction enzymes, then ligated to the PGEX-2TK vector (Amersham Phannacia Biotech, Uppsala, Sweden). Recombinants expressing LLG-C4-GST were confirmed by DNA sequencing. LLG-C4-GST was produced in E. coli strain BL21 and the product was purified by glutathione affinity chromatography followed by dialysis. An ICAM-1-Fc fusion protein containing five ICAM-1 Ig domains was produced in CHO cells and purified by protein A affinity chromatography. About 20 mg of LLG-C4-GST was produced, and its purity reached more than 95% as analyzed by SDS gel electrophoresis on a PhastSyst...
Embodiment 3
[0082] Example 3. Cell Culture and Adhesion of Cell Lines to Nonapeptide Ligands
[0083] Jurkat T-cell leukemia (ATCC no.TIB-152), U-937 histiocytic lymphoma (no.CRL-1593.2) and K562 erythroleukemia (no.45507) cell lines were maintained in RPMI 1640 medium, in which Added 2mM glutamic acid, 10mM HEPES, 1mM sodium pyruvate, penicillin (100U / ml), streptomycin (100μg / ml) and 10% fetal calf serum (FCS). THP-1 monocytic leukemia cells (ATCC TIB-202) were cultured in the same medium additionally containing 0.05 mM 2-mercaptoethanol. The nonleukocyte cell lines Eahy926, HT1080, KS6717 and SKOV-3 were cultured as previously described (Koivunen et al., 1999). T cells were isolated from the buffy coat of blood by Ficoll-Hypaque centrifugation after passing through a nylon column (Valmu and Gahmberg, 1995). Wild-type murine L929 cells and α X beta 2 Integrin-transfected L-cell lines were obtained from Dr. Y. van Kooyk (University Hospital, Nijmegen, NL)
[0084] cell adhesion
[0...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More