Pig's epidermal growth factor gene and its application

An epidermal growth factor and gene technology, applied in the field of genetic engineering, can solve the problems of high price and difficult to meet production needs, and achieve the effects of low production cost and simple purification

Inactive Publication Date: 2007-06-06
SOUTH CHINA AGRI UNIV
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, only Australia's Gropep company has a commercial product (E. coli expression product), but the price is expensive (325 US dollars / 1mg), and it is difficult to meet the production needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig's epidermal growth factor gene and its application
  • Pig's epidermal growth factor gene and its application
  • Pig's epidermal growth factor gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Construction of expression vector

[0027] According to the amino acid sequence of pEGF and the codon preference of Pichia pastoris, the pEGF gene was artificially synthesized. Its nucleotide sequence and its coded amino acid sequence are respectively shown in SEQ ID NO.1 and 2 of the sequence listing. The above sequence was synthesized by Shanghai Yingjun Company. Using the synthetic pEGF gene as a template, design a pair of primers so that the 5' end of the upstream primer contains the sequence between Xho I and SnaB I on the pPIC9 vector, and the 5' end of the downstream primer contains 6 histidines, a TGA Stop codon and EcoR I site, the upstream primer used in this example is: 5'GCGCGCTCGAGAAAAGAGAGGCTGAAGCTAATTCTTACTCTGAATGTCCCAC, the downstream primer: 5'GGGCCGAATTCTCAATGATGATGATGATGATGTCTCAACTCCCACCATTTCAAG. PCR amplification was performed using this pair of primers. The PCR product and the pPIC9 vector were digested with Xho I and EcoR I respectivel...

Embodiment 2

[0031] Example 2. Preparation, transformation and screening of transformant phenotypes of competent host bacteria

[0032] Common solutions and media for yeast expression systems:

[0033] 10×D: Weigh 20g of D-glucose, add double distilled water to 100mL, heat until completely dissolved, filter or autoclave, store at 4°C, and the storage period is one year.

[0034] YPD medium (Yeast Extract Peotone Dextrose Medium): Weigh 10 g of yeast extract and 20 g of tryptone, dissolve in 900 mL of double distilled water, autoclave for 20 min, and then add 100 mL of sterilized 10×D.

[0035] 10×YNB (13.4% Yeast Nitrogen Base with Ammonium Sulfate without Amino Acid): Weigh 67g of Yeast Nitrogen Base (YNB), add double distilled water to 500mL, heat until completely dissolved, filter and sterilize, store at 4°C, shelf life for one year.

[0036] 500×B (0.02% D-Biotin, D-biotin): Weigh 10mg of D-biotin, add double distilled water to 50mL, heat until completely dissolved, filter and steril...

Embodiment 3

[0054] Example 3 Dot hybridization screening of multi-copy integrated transformants

[0055] Yeast lysis buffer: 0.01M Tris-Cl (pH7.6), 0.5M EDTA (pH8.0), β-mercaptoethanol (1% V / V).

[0056] Dot blot solution (1×): 20×SSC 250mL, 5% SDS 5mL, 10% Sarkosyl 10mL, ddH 2 O 735mL, Blocking Reagent 5g.

[0057] The phenotype-determined transformants were placed in a 96-well plate containing 100 μl of YPD medium per well, cultured at 30°C for 48 h, 10 μl was inoculated into a 96-well plate containing 100 μl of fresh YPD medium per well, and cultured for 48 h. Then take 50 μl of the cultured bacterial solution from each well in a 2ml centrifuge tube, centrifuge to remove the supernatant, resuspend the cell pellet with 80 μl of yeast lysis buffer containing yeast lyase (lyticase), lyse at 37°C for 4 hours, and then act at 100°C for 10 minutes , immediately put the centrifuge tube in ice, and add an equal volume of 20×SSC to obtain the lysate. Using a dot blot injector, transfer the p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention provides one kind of pig's epidermal growth factor gene with the nucleotide sequence shown in SEQ ID No. 1 of the sequence list. The present invention provides also the gene engineering bacterium C32 containing 14 copies of the gene, and the gene engineering bacterium has high pEGF expressing amount, simple purifying process and low production cost. The present invention makes it possible to produce pig's epidermal growth factor gene in industrial scale.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a porcine epidermal growth factor gene, and also relates to an expression vector constructed by the gene and a transformant thereof. Background technique [0002] Epidermal growth factor is a protein that Cohen (1962) isolated from the submandibular gland of male mice in the 1960s, which can make the eyelids of newborn mice open early and the teeth erupt early. Later, human epidermal growth factor was isolated from human urine in 1975. Human and mouse epidermal growth factor can stimulate the proliferation of epidermal and endothelial cells, and can be used to treat burns, corneal trauma, gastrointestinal ulcers, etc. In 1991, the porcine epidermal growth factor gene was cloned and expressed in yeast. It was found that the expressed porcine epidermal growth factor could promote the DNA synthesis of Kunming mouse 3T3 cells (Pascall JC, Jones DS, Doel SM, Clements JM, Hunter M, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/63C12N15/81C12N1/19C07K14/485C12R1/84
Inventor杨桂香汪洋彭险峰黄显会陈杖榴曾振灵吴波浪
OwnerSOUTH CHINA AGRI UNIV