Unlock instant, AI-driven research and patent intelligence for your innovation.

Homogentisate prenyl transferase ("HPT") nucleic acids and polypeptides, and uses thereof

a technology of homogeneous prenyl transferase and prenyl transferase, which is applied in the directions of transferases, enzymology, organic chemistry, etc., can solve the problems of relatively high cost of supplements and difficult to achieve the recommended daily intake of 15-30 mg of vitamin e from the average american di

Inactive Publication Date: 2007-04-05
VALENTIN HENRY E +2
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The recommended daily dietary intake of 15-30 mg of vitamin E is quite difficult to achieve from the average American diet.
Furthermore, supplements tend to be relatively expensive, and the general population is disinclined to take vitamin supplements on a regular basis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Homogentisate prenyl transferase ("HPT") nucleic acids and polypeptides, and uses thereof
  • Homogentisate prenyl transferase ("HPT") nucleic acids and polypeptides, and uses thereof
  • Homogentisate prenyl transferase ("HPT") nucleic acids and polypeptides, and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Identification of Homogentisate Prenyl Transferase Sequences

[0374] This example sets forth methods used to analyze homogentisate prenyl transferase sequences from various sources in order to identify motifs common to homogentisate prenyl transferase that are contained therein.

[0375] Homogentisate prenyl transferase sequences from Soy, Arabidopsis, Corn and Cuphea (partial) are cloned and sequenced from EST sequences found in an EST database. Synechocystis, Nostoc, and Anabaena are obtained from Genbank. These sequences (representing SEQ ID NOs: 1-8) are then aligned with respect to each other using the multiple alignment software ClustalX, which is described by Thompson et al., Nucleic Acids Research, 24:4876-4882 (1997). The multiple alignment of the protein sequences is visualized and edited using Genedoc, which is described by Nicholas et al., EMBNEW.NEWS, 4:14 (1997).

[0376] Using the aforementioned multiple alignment tool, four motifs (A-D) are identified, as shown in FIGS. 2...

example 2

Preparation of Expression Constructs

[0379] A plasmid containing the napin cassette derived from pCGN3223 (described in U.S. Pat. No. 5,639,790, the entirety of which is incorporated herein by reference) is modified to make it more useful for cloning large DNA fragments containing multiple restriction sites, and to allow the cloning of multiple napin fusion genes into plant binary transformation vectors. An adapter comprised of the self annealed oligonucleotide of sequence CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCGCCATTTAAAT (SEQ ID NO: 16) is ligated into the cloning vector pBC SK+ (Stratagene) after digestion with the restriction endonuclease BssHII to construct vector pCGN7765. Plasmids pCGN3223 and pCGN7765 are digested with NotI and ligated together. The resultant vector, pCGN7770, contains the pCGN7765 backbone with the napin seed specific expression cassette from pCGN3223.

[0380] The cloning cassette pCGN7787 comprises essentially the same regulatory elements as pCGN7770,...

example 3

Plant Transformation

[0399] Transgenic Brassica plants are obtained by Agrobacterium-mediated transformation as described by Radke et al., Theor. Appl. Genet., 75:685-694 (1988); Plant Cell Reports, 11:499-505 (1992). Transgenic Arabidopsis thaliana plants may be obtained by Agrobacterium-mediated transformation as described by Valverkens et al., Proc. Nat. Acad. Sci., 85:5536-5540 (1988), or as described by Bent et al., Science, 265:1856-1860 (1994), or Bechtold et al., C.R. Acad. Sci. Life Sciences, 316:1194-1199 (1993). Other plant species may be similarly transformed using related techniques.

[0400] Alternatively, microprojectile bombardment methods, such as described by Klein et al., Bio / Technology, 10:286-291 may also be used to obtain nuclear transformed plants.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
weightaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

The present invention is in the field of plant genetics and biochemistry. More specifically, the present invention relates to genes and polypeptides associated with the tocopherol biosynthesis pathway, namely those encoding homogentisate prenyl transferase activity, and uses thereof.

Description

[0001] This application claims priority to U.S. No. 60 / 365,202 filed Mar. 19, 2002, the disclosure of which is incorporated herein by reference in its entirety.[0002] The present invention is in the field of plant genetics and biochemistry. More specifically, the present invention relates to genes and polypeptides associated with the tocopherol biosynthesis pathway, namely those encoding homogentisate prenyl transferase activity, and uses thereof. [0003] Isoprenoids are ubiquitous compounds found in all living organisms. Plants synthesize a diverse array of greater than 22,000 isoprenoids (Connolly and Hill, Dictionary of Terpenoids, Chapman and Hall, New York, N.Y. (1992)). In plants, isoprenoids play essential roles in particular cell functions such as production of sterols, contributing to eukaryotic membrane architecture, acyclic polyprenoids found in the side chain of ubiquinone and plastoquinone, growth regulators like abscisic acid, gibberellins, brassinosteroids or the photo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A01H1/00C07H21/04C12N9/10C12N15/82C12N5/04C12N15/29
CPCC12N15/8243
Inventor VALENTIN, HENRY E.VENKATESH, TYAMAGONDLU V.BALASULOJINI, KARUNANANDAA
Owner VALENTIN HENRY E
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More