Production of Vectors for Non-Dividing Host Cells
a vector and non-dividing host cell technology, applied in the field of methods, can solve the problems of batch-to-batch variation, inability to meet the needs of lentiviruses, and inability to meet the needs of stable cell lines,
Inactive Publication Date: 2016-04-07
TRIZELL LTD
View PDF3 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
[0005]Baculovirus-produced lentiviruses transduced mammalian cells as efficient as conventionally produced lentiviruses. Different baculovirus concentrations were used to find optimal baculovirus concentration for lentivirus production. The un-concentrated lentiviral titers in cell culture mediums were on avarege 1.21×108 TU / ml which are comparable to titers of the lentivirus produced by conventional four plasmid method. Lentivirus transduced Hela cells were grown three months without loosing the GFP expression. Our results show for the first time that baculoviruses can be used for the production of lentiviruses in mammalian cells. Baculovirus technology offers an attractive possibility to scalable virus production as a result of ease production and concentration of baculovirses, efficient transduction of suspension mammalian cells in serum free conditions and safety of the baculoviruses. The lentiviral vector may also be produced with the baculovirus capsid-displaying viral protein rev, tat, net, vit or vpu, by fusing the viral protein to a baculovirus protein. The baculovirus protein may be the capsid protein, vp39. Further, the lentivirus may be produced using a transgene or transgene cassette.
Problems solved by technology
Currently there is no optimal large scale packaging system available for lentiviruses.
Stable cell lines suffer from the gene silencing that occurs during the long culture periods needed for sequential addition of packaging constructs.
On the contrary, transient plasmid-based production systems are very laborious and inefficient, and suffer from batch-to-batch variation.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment Construction
Materials and Methods
[0011]Constructs needed for the HIV-1 based lentivirus vector production were subcloned to baculovirus donor vectors pFastBac1 (Invitrogen, Carlsbad, Calif., USA) driven by the human cytomegalovirus (CMV) promoter. Lentivirus transfer construct was a third-generation self-inactivating vector expressing GFP marker gene driven by the phosphoglycerate kinase (PGK) promoter. Transfer construct was isolated from plasmid LV1-GFP in two parts and subcloned into pBAC-transfer donor vector polylinker. This PmlI / NheI / PstI / SalI / AfllI / PacI / SpeI / MluI / PmeI / EcoRI / ApaI / SwaI / AscI-polylinker was earlier cloned to the AvrlI site of pFastBac1. The sequence of the polylinker was 5′CACGTGGCTAGCCTGCAGGTCGACCTTAAGTTAATTAAACTAGTACGCGTGTTTA AACGAATTCGGGCCCATTTAAATGGCGCGCC-3′. The donor vector had also red marker gene DsRed cloned under polyhedrin promoter for easy baculovirus tittering (Mähönen et al. unpublished data). First part of the transfer construct was digested by BsrBI and AscI ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
| Property | Measurement | Unit |
|---|---|---|
| stable | aaaaa | aaaaa |
| viral surface | aaaaa | aaaaa |
| concentration | aaaaa | aaaaa |
Login to View More
Abstract
A high-volume gene therapy vector manufacturing process, entailing using a recombinant baculovirus to transform a producer cell, which producer cell in turn produces a recombinant gene therapy vector which is able to transform host cells even when they are not dividing.
Description
FIELD OF THE INVENTION[0001]The invention relates to methods for the production of lentiviral vectors.BACKGROUND OF THE INVENTION[0002]Lentiviruses, such as Human Immunodeficiency Virus I, are promising tools for gene therapy due to their ability to transduce and integrate into genome of both dividing and non-dividing cells. Lentiviral vectors can be pseudotyped by various viral surface proteins such the envelope glycoprotein G of the vesicular stomatitis virus (VSV-G). Pseudotyping broadens the transduction range of lentiviruses and long-term transgene expression has been obtained in many different cells and tissues (Delenda, 2004). Pseudotyping also strengthens fragile lentiviruses and enables concentration to high titers by ultrasentrifugation (Burns et al., 1993).[0003]The third generation lentiviral vector particles are commonly prepared by transient plasmid transfection in the 293T human embryonic kidney (HEK 293T) cells. Transfection is made by cotransfecting i) packaging pla...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Applications(United States)
IPC IPC(8): C12N15/86
CPCC12N15/86A61K48/00C12N2710/14051A61K48/0091C07K14/005C12N2740/16022C12N2740/16043C12N2740/16045C12N2740/16051C12N2810/6081C12N15/79C12N15/64C12N7/00C12N2710/14021C12N2710/14043C12N2740/15043C12N2740/15051
Inventor LESCH, HANNA P.AIRENNE, KARI J.YLA-HERTTUALA, SEPPO
Owner TRIZELL LTD