Crispr-based genome modification and regulation

a genome modification and regulation technology, applied in the direction of peptides/protein ingredients, enzyme stabilisation, peptides, etc., can solve the problems of high cost and time-consuming preparation of custom-designed nucleases

Inactive Publication Date: 2016-10-13
SIGMA ALDRICH CO LLC
View PDF4 Cites 68 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Thus, these custom designed nucleases tend to be costly and time-consuming to prepare.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Crispr-based genome modification and regulation
  • Crispr-based genome modification and regulation
  • Crispr-based genome modification and regulation

Examples

Experimental program
Comparison scheme
Effect test

example 1

Modification of Cas9 Gene for Mammalian Expression

[0161]A Cas9 gene from Streptococcus pyogenes strain MGAS15252 (Accession number YP_005388840.1) was optimized with Homo sapiens codon preference to enhance its translation in mammalian cells. The Cas9 gene also was modified by adding a nuclear localization signal PKKKRKV (SEQ ID NO:1) at the C terminus for targeting the protein into the nuclei of mammalian cells. Table 1 presents the modified Cas9 amino acid sequence, with the nuclear localization sequence underlined. Table 2 presents the codon optimized, modified Cas9 DNA sequence.

TABLE 1Modified Cas9 Amino Acid Sequence(SEQ ID NO: 9)MDKKYSIGLDIGTNSVGWAVITDDYKVPSKKFKVLGNTDRHSIKKNLIGALLFGSGETAEATRLKRTARRRYTRRKNRICYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLADSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNSDVDKLFIQLVQIYNQLFEENPINASRVDAKAILSARLSKSRRLENLIAQLPGEKRNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNSEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQ...

example 2

Targeting Cas9

[0163]The adeno-associated virus integration site 1 (AAVS1) locus was used as a target for Cas9-mediated human genome modification. The human AAVS1 locus is located in intron 1 (4427 bp) of protein phosphatase 1, regulatory subunit 12C (PPP1R12C). Table 3 presents the first exon (shaded gray) and the first intron of PPP1R12C. The underlined sequence within the intron is the targeted modification site (i.e., AAVS1 locus).

TABLE 3First Exon and Intron of PPP1R12C (5′-3′)CAGGTCCACCCTCTGCTGCGCCACCTGGGGCATCCTCCTTCCCCGTTGCCAGTCTCGATCCGCCCCGTCGTTCCTGGCCCTGGGCTTTGCCACCCTATGCTGACACCCCGTCCCAGTCCCCCTTACCATTCCCCTTCGACCACCCCACTTCCGAATTGGAGCCGCTTCAACTGGCCCTGGGCTTAGCCACTCTGTGCTGACCACTCTGCCCCAGGCCTCCTTACCATTCCCCTTCGACCTACTCTCTTCCGCATTGGAGTCGCTTTAACTGGCCCTGGCTTTGGCAGCCTGTGCTGACCCATGCAGTCCTCCTTACCATCCCTCCCTCGACTTCCCCTCTTCCGATGTTGAGCCCCTCCAGCCGGTCCTGGACTTTGTCTCCTTCCCTGCCCTGCCCTCTCCTGAACCTGAGCCAGCTCCCATAGCTCAGTCTGGTCTATCTGCCTGGCCCTGGCCATTGTCACTTTGCGCTGCCCTCCTCTCGCCCCCGAGTGCCCTTGCTGTGCCGCCG...

example 3

Preparation of Donor Polynucleotide to Monitor Genome Modification

[0165]Targeted integration of a GFP protein into the N terminus of PPP1R12C was used to monitor Cas9-mediated genome modification. To mediate integration by homologous recombination a donor polynucleotide was prepared. The AAVS1-GFP DNA donor contained a 5′ (1185 bp) AAVS1 locus homologous arm, an RNA splicing receptor, a turbo GFP coding sequence, a 3′ transcription terminator, and a 3′ (1217 bp) AAVS1 locus homologous arm. Table 5 presents the sequences of the RNA splicing receptor and the GFP coding sequence followed by the 3′ transcription terminator. Plasmid DNA was prepared by using GenElute Endotoxin-Free Plasmid Maxiprep Kit (Sigma).

TABLE 5Sequences in the AAVS1-GFP DNA donor sequenceSEQ ID5′-3′ SequenceNO:RNA splicingCTGACCTCTTCTCTTCCTCCCACAG15receptorGFP codingGCCACCATGGACTACAAAGACGATG16sequence andACGACAAGGTCGACTCTAGAGCTGCtranscriptionAGAGAGCGACGAGAGCGGCCTGCCCterminatorGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
nucleic acidaaaaaaaaaa
timeaaaaaaaaaa
fluorescenceaaaaaaaaaa
Login to View More

Abstract

The present invention provides RNA-guided endonucleases, which are engineered for expression in eukaryotic cells or embryos, and methods of using the RNA-guided endonuclease for targeted genome modification in in eukaryotic cells or embryos. Also provided are fusion proteins, wherein each fusion protein comprises a CRISPR / Cas-like protein or fragment thereof and an effector domain. The effector domain can be a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Also provided are methods for using the fusion proteins to modify a chromosomal sequence or regulate expression of a chromosomal sequence.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is a divisional application of U.S. patent application Ser. No. 14 / 649,777, filed Jun. 4, 2015, which is a U.S. National Stage Application of PCT International Application No. PCT / US2013 / 073307, filed Dec. 5, 2013, which claims priority to U.S. Provisional Application Ser. No. 61 / 734,256, filed Dec. 6, 2012; U.S. Provisional Application Ser. No. 61 / 758,624, filed Jan. 30, 2013; U.S. Provisional Application Ser. No. 61 / 761,046, filed Feb. 5, 2013; and U.S. Provisional Application Ser. No. 61 / 794,422, filed Mar. 15, 2013, the disclosure of each is hereby incorporated by reference in its entirety.FIELD OF THE INVENTION[0002]The present disclosure relates targeted genome modification. In particular, the disclosure relates to RNA-guided endonucleases or fusion proteins comprising CRISPR / Cas-like protein and methods of using said proteins to modify or regulate targeted chromosomal sequences.BACKGROUND OF THE INVENTION[0003]Targ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/90C12N15/11C12N7/00C12N15/86C12N9/22C07K7/06
CPCC12N15/907C12N9/22C12Y301/00C07K7/06C12Y301/21004C12N2310/3513C12N15/86C12N15/11C07K2319/09C12N2750/14143C12N7/00A61K38/00C12N15/102C12N15/63C12N9/96Y02A50/30C12N2800/22C12N15/85C12N2800/80C12N15/67C07K2319/81C07K2319/10C07K14/463C12N2310/20A61K9/0048A61P27/10
InventorCHEN, FUQIANGDAVIS, GREGORY D.KANG, QIAOHUAKNIGHT, SCOTT W.
OwnerSIGMA ALDRICH CO LLC