Compositions and methods for synthetic gene assembly

a technology of synthetic genes and assembly methods, applied in the field of synthetic gene assembly, can solve the problems of scalability, automation, speed, accuracy, cost, and limited assembly of nucleic acids from shorter segments, and achieve the effect of high fidelity

Inactive Publication Date: 2017-06-08
TWIST BIOSCI
View PDF4 Cites 46 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

While various methods are known for the synthesis of relatively short fragments of nucleic acids in a small scale, these techniques suffer from scalability, automation, speed, accuracy, and cost.
In many cases, the assembly of nucleic acids from shorter segments is limited by the availability of non-degenerate overhangs that can be annealed to join the segments.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for synthetic gene assembly
  • Compositions and methods for synthetic gene assembly
  • Compositions and methods for synthetic gene assembly

Examples

Experimental program
Comparison scheme
Effect test

example 1

on Enzyme-Free Ligation of a Gene Fragment Using Sticky Ends

[0150]Amplification with Uracil-Containing PCR Primers

[0151]A gene of about 1 kB (the “1 kB Gene Construct”) was selected to perform restriction enzyme-free ligation with a vector:

(SEQ ID NO.: 48)5′CAGCAGTTCCTCGCTCTTCTCACGACGAGTTCGACATCAACAAGCTGCGCTACCACAAGATCGTGCTGATGGCCGACGCCGATGTTGACGGCCAGCACATCGCAACGCTGCTGCTCACCCTGCTTTTCCGCTTCATGCCAGACCTCGTCGCCGAAGGCCACGTCTACTTGGCACAGCCACCTTTGTACAAACTGAAGTGGCAGCGCGGAGAGCCAGGATTCGCATACTCCGATGAGGAGCGCGATGAGCAGCTCAACGAAGGCCTTGCCGCTGGACGCAAGATCAACAAGGACGACGGCATCCAGCGCTACAAGGGTCTCGGCGAGATGAACGCCAGCGAGCTGTGGGAAACCACCATGGACCCAACTGTTCGTATTCTGCGCCGCGTGGACATCACCGATGCTCAGCGTGCTGATGAACTGTTCTCCATCTTGATGGGTGACGACGTTGTGGCTCGCCGCAGCTTCATCACCCGAAATGCCAAGGATGTTCGTTTCCTCGATATCTAAAGCGCCTTACTTAACCCGCCCCTGGAATTCTGGGGGCGGGTTTTGTGATTTTTAGGGTCAGCACTTTATAAATGCAGGCTTCTATGGCTTCAAGTTGGCCAATACGTGGGGTTGATTTTTTAAAACCAGACTGGCGTGCCCAAGAGCTGAACTTTCGCTAGTCATGGGCATTCCTGGCCGGTTTCTTGGCCTTCAAACCGGACAGGAATGCCCAAGTTAACGGAAAAACC...

example 2

of LacZ Gene into a Plasmid

[0157]A LacZ gene was assembled into a 5 kb plasmid from three precursor LacZ fragments and 1 precursor plasmid fragment. Assembly was performed using 9 different reaction conditions.

[0158]Preparation of Precursor Plasmid Fragments

[0159]A 5 kb plasmid was amplified with two different sets of primers for introducing a sticky end motif comprising a non-canonical base (SEQ ID NO.: 53): set A (SEQ ID NOs.: 54 and 55) and set B (SEQ ID NOs.: 56 and 57), shown in Table 6, to produce plasmid precursor fragments A and B, respectively.

TABLE 6Sequence identities of plasmid primers.SequencePrimeridentitynameSequenceSEQ IDplasmid-FaTGATCGGCAATGATATG / ideoxyU / CTGNO.: 54GAAAGAACATGTGSEQ IDplasmid-RaTGATCGGCAATGATGGC / ideoxyU / TATNO.: 55AATGCGACAAACAACAGSEQ IDplasmid-FbTGATCGGCAATGATATG / ideoxyU / CGCNO.: 56TGGAAAGAACATGSEQ IDplasmid-RaTGATCGGCAATGATGGC / ideoxyU / CGTNO.: 57ATAATGCGACAAACAAC

[0160]Each primer set comprises, in 5′ to 3′ order: 6 adaptor bases (TGATCG, SEQ ID NO.: 5...

example 3

torial Target Nucleic Acid Library

[0169]An enzyme of interest having an activity to be improved is selected. Specific amino acid residues relevant to enzyme activity and stability are identified. The nucleic acid sequence encoding the enzyme is obtained. Bases corresponding to the specific amino acid residues are identified, and the nucleic acid is partitioned into fragments such that each fragment spans a single base position corresponding to a specific amino acid residue.

[0170]Target nucleic acid fragments are synthesized such that identified bases corresponding to the specific amino acid residues are indeterminate. Target nucleic acid fragments are amplified using a uridine primer and treated with a sequence adjacent nick enzyme and a uridine-specific nick enzyme. Cleaved end sequence is removed and target nucleic acid fragments are assembled to generate a target nucleic acid library. Aliquots of the library are sequenced to confirm success of the assembly, and aliquoted molecule...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to view more

Abstract

Methods and compositions are provided for assembly of large nucleic acids where the assembled large nucleic acids lack internal sequence modifications made during the assembly process.

Description

CROSS-REFERENCE[0001]This application is a Divisional of U.S. patent application Ser. No. 15 / 154,879 filed May 13, 2016, which is a Continuation of PCT / US16 / 16636 filed Feb. 4, 2016, which claims the benefit of U.S. Provisional Application No. 62 / 112,022 filed Feb. 4, 2015, which are herein incorporated by reference in their entirety.SEQUENCE LISTING[0002]The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jan. 25, 2016, is named 44854_709_401_SL.txt and is 41,005 bytes in size.BACKGROUND[0003]De novo nucleic acid synthesis is a powerful tool for basic biological research and biotechnology applications. While various methods are known for the synthesis of relatively short fragments of nucleic acids in a small scale, these techniques suffer from scalability, automation, speed, accuracy, and cost. In many cases, the assembly of nucleic acids from...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N15/10C12P19/34
CPCC12N15/1031C12N15/1093C12P19/34C12N15/1027C12N15/66
Inventor TORO, ESTEBANTREUSCH, SEBASTIANCHEN, SIYUANWU, CHENG-HSIEN
Owner TWIST BIOSCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap