Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-clusterin monotherapy for cancer treatment

a cancer treatment and anti-clusterin technology, applied in the field of anti-clusterin monotherapy for cancer treatment, can solve the problem that custirsen is not known to be effective for the treatmen

Inactive Publication Date: 2016-06-07
ONCOGENEX TECH INC
View PDF31 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Custirsen is not known to be effective for the treatment of cancer as a monotherapy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

In Vivo Activity of Custirsen Against RPMI 8226 (Human Myeloma) Xenograft Model, Implanted Subcutaneously into Athymic Nude Mice

Summary

[0060]This study aimed to evaluate the effect of custirsen (OGX-11, TV-1011) against human myeloma model in nude mice. The cells were implanted subcutaneously into female SCID mice with 7×106 cells inoculum. On day 20, when the tumors reached 120-170 mm3, mice were sorted into two treatment groups (n=10): control group; and custirsen 40 mg / kg ip qd*5, then twk.

[0061]Tumors and body weights were measured weekly until termination of the study on day 71. Response to treatment was evaluated for tumor growth inhibition (TGI) and tumor growth delay (TGD).

[0062]Treatment with custirsen at a dose of 40 mg / kg was stopped after 7 injections due to toxicity. Nevertheless, as a monotherapy it significantly inhibited tumor growth by the end of the study.

Introduction

[0063]The objective of this study was to evaluate the effect of custirsen (OGX-11, Tv-1011) against...

example 2

In Vivo Activity of Custirsen (TV-1011) Against RPMI 8226 (Human Myeloma) Xenograft Model, Implanted Subcutaneously into Athymic Nude Mice

[0079]A previous in-house study demonstrated that custirsen had an inhibitory effect on tumor growth, but also showed unacceptable toxicity at a high dose.

[0080]In this study custirsen is administered using a different dose and regimen in order to avoid toxicity.

Materials and Methods

Test Articles

[0081]RPMI 8226 (Human Plasmacytoma, Myeloma B Cells) ATCC # CCL-155;[0082]ECM Gel (Matrigel), Sigma-Aldrich, Cat # E1270, 5 ml;[0083]RPMI (Beit Haemek);[0084]Custirsen (TV-1011) 20 mg / ml, K-46138;[0085]Sodium chloride, TEVA.

Test Animals

[0086]120 CB.17 SCID female mice, 4-6 weeks old, 16-20 grams, obtained from Harlan animal breeding center.

Experimental Procedures

Cells Preparation

[0087]Cells (originated from ATCC) were cultured on RPMI medium. Cell suspension was centrifuged and resuspended in 50% Matrigel / HBSS to a final concentration of 7×107 cells / ml. T...

example 3

In Vivo Activity of Custirsen (OGX-11) Against PC-3 (Human Prostate Carcinoma) Xenograft Model, Implanted Subcutaneously into Athymic Nude Mice

[0100]The cells were implanted subcutaneously into female immunodeficient nude mice. On day 14, when the tumors reached 90-135=3, mice were sorted into treatment groups (n=10): 1. Control group was treated with saline i.p. qd*7+twk; 2. Custirsen treatment (25 mg / kg ip qd*5+twk).

[0101]Tumors and body weights were measured once a week until termination of the study on day 58 included. Response to treatment was evaluated for tumor growth inhibition (TGI) and expressed as the difference between the mean tumor volumes of treated and control mice.

Materials and Methods

a. Materials

[0102]PC-3 (Human Prostate Adenocarcinoma), ATCC, CAL-1435™[0103]RPMI medium 1640+L-Glutamine (Beit Haemek)[0104]Custirsen (OGX) 20 mg / ml, K-46138;[0105]The custirsen solution was prepared once weekly and stored at 4° C. 4.0 ml of the stock solution of custirsen (20 mg / ml) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
volumeaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.

Description

[0001]This application claims the benefit of U.S. Provisional Application No. 61 / 782,584, filed Mar. 14, 2013, the contents of which is hereby incorporated by reference in its entirety.[0002]Throughout this application, various publications are referenced, including referenced in parenthesis. Full citations for publications referenced in parenthesis may be found listed in alphabetical order at the end of the specification immediately preceding the claims. The disclosures of all referenced publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.REFERENCE TO SEQUENCE LISTING[0003]This application incorporates-by-reference nucleotide and / or amino acid sequences which are present in the file named “140312_2609_85022_Sequence_Listing_ACK.txt,” which is 1 kilobyte in size, and which was created Mar. 11, 2014 in the IBM-PC machine format, having an operating system comp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(United States)
IPC IPC(8): A61K31/70C07H21/02C07H21/04C12N15/113A61K31/711C12Q1/68
CPCC12N15/113A61K31/711C12N2310/11C12N2310/315C12N2310/3341C12N2310/341C12N2310/346C12N2320/35
Inventor TESSLER, SHOSHIKAYE, JOELFINE, TANIAKASHI, RINA
Owner ONCOGENEX TECH INC