Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

77 results about "Clusterin" patented technology

Clusterin (apolipoprotein J) is a 75 - 80 kDa disulfide-linked heterodimeric protein associated with the clearance of cellular debris and apoptosis. In humans, clusterin is encoded by the CLU gene on chromosome 8. CLU is a molecular chaperone responsible for aiding protein folding of secreted proteins, and its three isoforms have been differentially implicated in pro- or antiapoptotic processes. Through this function, CLU is involved in many diseases related to oxidative stress, including neurodegenerative diseases, cancers, inflammatory diseases, and aging.

Lipoprotein-associated markers for cardiovascular disease

The invention provides methods of screening a mammalian subject to determine if the subject is at risk to develop, or is suffering from, cardiovascular disease. The methods comprise detecting an amount of at least one biomarker in a biological sample, or HDL subfraction thereof, from the subject, and comparing the detected amount of the biomarker to a predetermined value, where a difference between the detected amount and the predetermined value is indicative of the presence or risk of cardiovascular disease in the subject. In some embodiments, the biomarker comprises at least one of ApoC-IV, Paraoxonase 1, C3, C4, ApoA-IV, ApoE, ApoL1, C4B1, Histone H2A, ApoC-II, ApoM, Vitronectin, Haptoglobin-related protein, and Clusterin, or combinations thereof.
Owner:UNIV OF WASHINGTON

Clusterin Antisense Therapy for Treatment of Cancer

A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and / or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament.
Owner:THE UNIV OF BRITISH COLUMBIA

Treatment of melanoma by reduction in clusterin levels

Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells of in a mammalian subject, preferably a human. A therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells is administered to the subject. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin. bcl-xL in a subject or cell line can also be regulated by administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis.
Owner:THE UNIV OF BRITISH COLUMBIA

Treatment of Cancer With a Combination of an Agent that Perturbs the EGF Signaling Pathway and an Oligonucleotide that Reduces Clusterin Levels

Agents that perturb the EGF signaling pathway and that are known to be useful in the treatment of cancer are found also to result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. This is overcome using a combination of an agent that has known therapeutic efficacy against the cancer to be treated by perturbation of the EGF signaling pathway and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells small molecule inhibitor of HER-2, an antisense oligonucleotide specific for HER-2, or a peptide agent capable of interfering with HER-2 protein. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.
Owner:THE UNIV OF BRITISH COLUMBIA

Use of clusterin for the treatment and/or prevention of peripheral neurological diseases

The invention relates to the use of clusterin, or of an agonist of clusterin activity, for treatment or prevention of peripheral neurological diseases, The invention further relates to the use of a combination of clusterin and heparin, for treatment or prevention of peripheral neurological diseases.
Owner:LAB SERONO SA

Composition and method for clusterin-mediated stem cell therapy for treatment of atherosclerosis and heart failure

Methods and compositions are disclosed for inhibiting, deterring or preventing apoptosis of cardiac myocytes, transplanted stem cells, vascular stem cells, and vascular smooth muscle cells by means of expressing or synthesizing clusterin. Also disclosed are methods and compositions for producing recombinant clusterin, or its biologically active peptides, and for induction of clusterin-associated lipoproteins or enzymes for deterring or preventing inflammatory injury and apoptosis induced by oxLDL, oxysterols, cytokines, and Fas Ligand. Also disclosed is an induction method and composition for enhancing expression of ALDH and ALDH-associated enzymes or co-factors to prevent cytotoxicity or detoxification. Therapeutic methods providing new expression or overexpression of clusterin in vascular or cardiac tissue are expected to inhibit the formation of atherosclerotic lesions, stabilize existing atherosclerotic plaques, and repair failing or damaged cardiac tissue.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Diagnosis Of Neurodegenerative Diseases

InactiveUS20080286263A1Improve trustNervous disorderElectrolysis componentsHemoglobin Beta ChainApolipoprotein C-II
The invention relates to a method of diagnosis of Huntington's Disease in a diagnostic sample of a valid body tissue taken from a human subject, which comprises detecting an altered concentration of a protein in the diagnostic sample, compared with a sample of a control human subject, the protein being selected from: Swiss Prot accession number: Protein name; P10909: Clusterin precursor; P00738: Haptoglobin precursor; P01009: Alpha-1-antitrypsin precursor; P01024: Complement C3 precursor; P01620: 1 g kappa chain V-III region; P01834: 1 g kappa chain C region P01842: 1 g lambda chain C regions; P01857: 1 g gamma-1 chain C region; P01859: Ig gamma-2 chain C region; P01876: 1 g alpha-1 chain C region P02647: Apolipoprotein A-I precursor; P02649: Apolipoprotein E precursor; P02652: Apolipoprotein A-II precursor; P02655: Apolipoprotein C-II precursor; P02656: Apolipoprotein C-II precursor P02671: Fibrinogen alpha / alpha-E chain precursor; P02763: Alpha-1-acid glycoprotein 1 precursor; P02766: Transthyretin precursor; P02768: Serum albumin precursor; P02787: Serotransferrin precursor; P04196: Histidine-rich glycoprotein precursor; P06727: Apolipoprotein A-IV precursor; P19652: Alpha-1-acid glycoprotein 2 precursor; P68871 / P02042: Hemoglobin beta chain / Hemoglobin delta chain; P60709: Beta actin.
Owner:ELECTROPHORETICS LTD

Markers and methods relating to the assessment of alzheimer's disease

InactiveUS20110082187A1Pronounced clinicalPronounced pathological stateCompound screeningOrganic active ingredientsDisease severityClusterin
Use of clusterin as a biomarker of Alzheimer's disease (AD), particularly methods and compositions for detection of clusterin in a biological sample and assessment of in vivo pathology, disease severity and rate of clinical progression in a subject having or suspected of having AD.
Owner:KING'S COLLEGE LONDON +1

Kit for distinguishing and diagnosing hepatocirrhosis and early liver cancer and application of serum clusterin in preparing same

The invention discloses a kit for diagnosing primary hepatoma, preparation method and application thereof. The kit can quickly and accurately carry out the clusterin detection so as to carry out quickauxiliary diagnosis on the primary hepatoma of each period; and the kit especially has an important clinical application value for distinguishing hepatocirrhosis and early liver cancer. The kit comprises an enzyme-linked immunological diagnosis system established on the basis of a double-antibody sandwich principle. The kit has high sensitivity, strong specificity, simple operation, stable reagent, good repeatability, easy popularization and application and extensive market prospect.
Owner:SUN YAT SEN UNIV

Serum clusterin levels in systemic amyloidosis featuring cardiomyopathy

The present invention relates generally to diagnostic methods, systems, assays and kits for identification of subjects with cardiac amyloid deposits, where a low level of clusterin protein in a peripheral fluid sample, e.g., a serum sample from the subject, indicates the subject likely has cardiac amyloid deposits. Other aspects relate to methods of treatment of diseases or disorders characterized by cardiac amyloid deposits and transthyretin (TTR) amyloidosis, and more particularly to methods of treatment of cardiac-related amyloidosis and cardiac amyloid deposits in subjects with familial transthyretin (TTR), senile systemic amyloidosis (SSA), or familial amyloidodic polyneuropathy (FAP), or immunoglobulin light chain (AL) amyloidosis. Other aspects relate to methods and compositions comprising clusterin (CLU) or a clusterin agent (e.g. an agonist of clusterin activity or a biologically active fragment or derivative thereof), and their use in methods to treat a disease or disorder characterized by transthyretin (TTR) amyloidosis, e.g. senile systemic amyloidosis (SSA) or familial amyloidodic polyneuropathy (FAP), and their use in methods to treat amyloidotic cardiomyopathy associated with transthyretin (TTR) amyloidosis.
Owner:TRUSTEES OF BOSTON UNIV

Diagnosis of prostate cancer

The present invention provides a method for determining the presence of prostate cancer in a subject which method comprises determining the level of expression of one or more markers in a blood sample from the subject, wherein said one or more markers comprise at least one of E2F3, c-met, pRB, EZH2, e-cad, CAXII, CAIX, HIF-1α, Jagged, PIM-1, hepsin, RECK, Clusterin, MMP9, MTSP-1, MMP24, MMP15, IGFBP-2, IGFBP-3, E2F4, caveolin, EF-1A, Kallikrein 2, Kallikrein 3 and PSGR.
Owner:ST GEORGES ENTERPRISES

Method for treating non-small cell lung cancer

A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.
Owner:THE UNIV OF BRITISH COLUMBIA +1

Treatment of cancer by inhibition of IGFBP's and clusterin

Agents that reduce the amount of IGFBP-2 and / or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and / or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and / or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.
Owner:THE UNIV OF BRITISH COLUMBIA

Combination of Anti-clusterin oligonucleotide with hsp90 inhibitor for the treatment of prostate cancer

The present invention provides a method for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Heat Shock Protein 90 (Hsp90) inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. The present invention also provides pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and a Hsp90 inhibitor for use in treating a mammalian subject affected by prostate cancer. Also provided are oligonucleotides which reduce clusterin expression for use in combination with a Hsp90 inhibitor in treating a mammalian subject affected by prostate cancer, and a composition for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject.
Owner:THE UNIV OF BRITISH COLUMBIA

Serum proteomic for finding diagnostic markers and for monitoring therapeutical intervention in treatment of hepatocellular carcinoma

The invention is directed to biomarkers for determining the EGFR kinase activity in a subject, and the use thereof for predicting and monitoring therapeutic intervention in cancer patients. Areas of application are the life sciences: biology, biochemistry, biotechnology, medicine and medical technology.The biomarkers are selected from a first group consisting of Amy 1, Apo Al, Carbx, Casp, AFP, ApoM, SAP, Fib-a, Fib-b, Fib-g, ApoE, A2MG, A2MG isoform, Serpin, Clusterin, MHC-fB, SAP isoform, or from a second group consisting of Gpx3, properidin, MUP1, HMW-K, Lifr-p, Orm 1, MBL-A, MBP-C, wherein the biomarkers are regulated by EGF overexpression in a subject.
Owner:BORLAK JURGEN +1

Treatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels

Agents that perturb the EGF signaling pathway and that are known to be useful in the treatment of cancer are found also to result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. This is overcome using a combination of an agent that has known therapeutic efficacy against the cancer to be treated by perturbation of the EGF signaling pathway and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. For example, the agent may be an antibody specific for HER-2, a small molecule inhibitor of HER-2, an antisense oligonucleotide specific for HER-2, or a peptide agent capable of interfering with HER-2 protein. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.
Owner:THE UNIV OF BRITISH COLUMBIA

Multiplex immunoassay for rheumatoid arthritis and other autoimmune diseases

Rheumatoid arthritis and other autoimmune diseases are diagnosed by multiplex assays for antibodies to a panel of antigens that includes cyclic citrullinated peptide and at least five members of a list that includes BRAF1 506-525, BRAF2 656-675, Vimentin (protein) citrullinated, Vimentin 415-433 cit cyclic, Vimentin 58-77 cit3 cyclic, Clusterin 231-250 cit sm1 cyclic, Fibrinogen A 556-575 cit sm cyclic, Fibrinogen A 616-635 cit sm cyclic, Histones2A H2A / a 1-20 cit sm2 cyclic, Filaggrin 48-65 cit2v1 cyclic, BRAF (catalytic domain from v raf murine sarcoma viral oncogene homologue B1, amino acids 416-766).
Owner:BIO RAD LAB INC

Diagnostic assay for alzheimer's disease

The present invention relates to the field of Alzheimer's disease (AD). More specifically, the present invention provides methods and compositions useful in diagnosing and assessing AD. In another embodiment, a method for diagnosing Alzheimer's Disease (AD) in a patient comprises the steps of (a) obtaining CSF sample from the patient; (b) adding to the sample isotopically labeled peptides identical to a portion of one or more biomarker proteins, wherein the one or more biomarker proteins comprise total APP, APP isoform 751, APP isoform 770, amyloid beta 40 peptide, APOE, and Clusterin; and (c) measuring the one or more biomarker proteins in the sample using mass spectrometry, wherein the level of one or more biomarker proteins compared to a control correlates with AD in the patient.
Owner:THE JOHN HOPKINS UNIV SCHOOL OF MEDICINE

Clusterin antisense therapy for treatment of cancer

A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and / or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament.
Owner:THE UNIV OF BRITISH COLUMBIA

Biomarkers for aggressive prostate cancer

ActiveUS20140106369A1Easy to useMicrobiological testing/measurementBiological testingCathepsin LMEMBRANE METALLOENDOPEPTIDASE
The present invention relates to the field of biomarkers and, more specifically, to biomarkers useful in diagnosing aggressive prostate cancer. In specific embodiments, a method for diagnosing aggressive prostate cancer in a patient comprises (a) measuring the levels of one or more biomarkers in a sample collected from the patient; and (b) comparing the levels of the one or more biomarkers with predefined levels of the same biomarkers that correlate to a patient having aggressive prostate cancer and predefined levels of the same biomarkers that correlate to a patient not having aggressive prostate cancer, wherein a correlation to one of the predefined levels provides the diagnosis. In a specific embodiment, the one or more biomarkers may comprise cathepsin-L (CTSL), periostin, microfibrillar-associated protein 4 (MFAP4), collagen XII, neprilysin, clusterin, neutrophil gelatinase associated lipocalin (NGAL), epithelial cell activating molecule (EpCAM), prostate specific antigen (PSA), membrane metallo-endopeptidase (MME) and asporin (ASPN).
Owner:THE JOHN HOPKINS UNIV SCHOOL OF MEDICINE

Clusterin-mediated inhibition of apoptosis via stromal bone marrow cell delivery to a cardiac site

Methods and compositions are disclosed for inhibiting, deterring or preventing apoptosis of cardiac myocytes, transplanted stem cells, vascular stem cells, and vascular smooth muscle cells by means of expressing or synthesizing clusterin. Also disclosed are methods and compositions for producing recombinant clusterin, or its biologically active peptides, and for induction of clusterin-associated lipoproteins or enzymes for deterring or preventing inflammatory injury and apoptosis induced by oxLDL, oxysterols, cytokines, and Fas Ligand. Also disclosed is an induction method and composition for enhancing expression of ALDH and ALDH-associated enzymes or co-factors to prevent cytotoxicity or detoxification. Therapeutic methods providing new expression or overexpression of clusterin in vascular or cardiac tissue are expected to inhibit the formation of atherosclerotic lesions, stabilize existing atherosclerotic plaques, and repair failing or damaged cardiac tissue.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Combination of Anti-clusterin oligonucleotide with androgen receptor antagonist for the treatment of prostate cancer

A method for treating a mammalian subject afflicted with prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) an androgen receptor antagonist having the structureor a pharmaceutically acceptable salt thereof, each in an amount that when in combination with the other is effective to treat the mammalian subject.
Owner:THE UNIV OF BRITISH COLUMBIA

Methods and compositions for modulating tumor cell activity

Antibodies which target clusterin, a protein involved in the epithelial-to-mesenchymal transition of carcinoma cells, are identified and characterized. The antibodies may be used to modulate tumour cell activity through binding the clusterin.
Owner:NAT RES COUNCIL OF CANADA

Method and kits for the diagnosis of diabetes

Provided are methods for the detection and diagnosis of a predisposition for developing diabetes. The methods are based on the discovery that abnormal levels of the selected analyte in biological samples, typically blood samples, of patients who are at risk are supportive of a diagnosis of a predisposition for developing diabetes. At least one new biomarker for a predisposition for diabetes is thus disclosed, IGF-1. Other important biomarkers for diabetes are described, including but not limited to ZAG, clusterin, corticosteroid-binding globulin, lumican, and serotransferrin. Kits containing reagents to assist in the analysis of biological samples are also described.
Owner:RULES BASED MEDICINE +1

Lipoprotein-associated markers for cardiovascular disease

The invention provides methods of screening a mammalian subject to determine if the subject is at risk to develop, or is suffering from, cardiovascular disease. The methods comprise detecting an amount of at least one biomarker in a biological sample, or HDL subfraction thereof, from the subject, and comparing the detected amount of the biomarker to a predetermined value, where a difference between the detected amount and the predetermined value is indicative of the presence or risk of cardiovascular disease in the subject. In some embodiments, the biomarker comprises at least one of ApoC-IV, Paraoxonase 1, C3, C4, ApoA-IV, ApoE, ApoL1, C4B1, Histone H2A, ApoC-II, ApoM, Vitronectin, Haptoglobin-related protein, and Clusterin, or combinations thereof.
Owner:UNIV OF WASHINGTON