15 results about "Sugar moiety" patented technology

Oligomeric compounds (including those that are antisense agents or portions thereof) are provided that comprise a modified oligonucleotide having at least one modified internucleoside linking group.SOLUTION: By an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 70 linked nucleosides linked via internucleoside linking groups, wherein at least one nucleoside comprises a modified sugar moiety and wherein at least one internucleoside linking group is a phosphodiester or phosphorothioate internucleoside linking group.SELECTED DRAWING: Figure 1

Provided herein is a noninvasive method for measuring pH, glucose and glycogen levels using a single acquisition method, as well as systems for performing the method. This method for glycogen / glucose (and pH) detection has high specificity enabled by superior chemical shift separation in high-strength magnetic fields. The methods have applications in detecting changing tumor microenvironments in cancerous cells for measuring important metrics for noninvasive and quantitative metabolic profiling.

The present invention provides a single-stranded antisense oligonucleotide or pharmaceutically acceptable salt thereof for regulating the expression and / or function of the ATXN7 gene. In the single-stranded antisense oligonucleotide, each nucleotide is bonded by a phosphate group and / or modified phosphate group. The single-stranded antisense oligonucleotide includes a gap region, a 3' wing region bonded to the 3' terminal of the gap region, and a 5' wing region bonded to the 5' terminal of the gap region. The gap region is a deoxyribose-constituted nucleic acid in which a nucleic acid modified by a sugar moiety may be included. The 3' wing region and the 5' wing region are modified nucleic acids. The sugar modification constituting the single-stranded antisense oligonucleotide is a modified nucleic acid represented by formula (A1). The single-stranded antisense oligonucleotide has a base length of 12-30 mer. The base sequence of the antisense oligonucleotide is: a base sequence having a sequence identity of 90-100% with a base sequence that is complementary to at least one target region constituted at the same base length as the antisense oligonucleotide in the base sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5; a base sequence that is complementary to the base sequence obtained by deleting, substituting, inserting, or adding one or more bases in the target region; or a base sequence that, under stringent conditions, hybridizes with an oligonucleotide having the target region.

The present disclosure provides enzymes and methods of using those enzymes to transfer sugar moieties to substrate steviol glycosides. Specifically, designed beta-1,2-glycosyltransferases and sucrose synthases are used in one-pot reactions to convert stevioside and Reb A to Reb E and Reb D. Additionally, designed beta-1,2-glycosyltransferases can be used in one-pot reactions with sucrose synthases and beta-1,3-glycosyltransferases to produce Reb M from stevioside and / or Reb A.

The present disclosure relates to a composition including one or more modified nucleotide, wherein the modified nucleotide comprises a purine or pyrimidine base and a sugar moiety having a 3′-hydroxy blocking group, and a radical scavenger, wherein the composition is lyophilised. The present disclosure further relates to a composition including one or more functional protein; one or more functional protein activator; and one or more non-reducing sugar, wherein the composition is lyophilised. Also disclosed are methods of rehydration of one or more compositions described herein and kits including one or more compositions described herein. Further disclosed are cartridges including a flow cell comprising one or more reagent reservoirs, where the one or more reagent reservoirs include one or more compositions described herein.

The present invention provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PLP1 RNA in cells or subjects, and, in some cases, the amount of proteolipid protein 1 in cells or subjects. [Solution] The present invention provides an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 85% complementary to equal-length portions of the PLP1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleoside-to-nucleoside bonds. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or characteristic of leukodystrophy.

The present disclosure provides enzymatic methods for the production of 3'-phosphatenucleoside-5'-triphosphate (NQP). The present disclosure further provides enzymatic methods for the production of nucleotide-5'-triphosphates. In some embodiments, a method of producing a nucleotide triphosphate with a phosphate group at the 3' position of the sugar moiety (NQP), the method comprising at least: contacting a nucleoside diphosphate (NDP) with a nucleoside diphosphate kinase, a 3' -O-kinase, and a phosphate donor under reaction conditions such that a NTP with a phosphate group on the 3' position of the sugar moiety (NQP) is produced.

The invention relates to novel silicon-based fluoride acceptor groups (SiFA groups) of the following formulae, as well as to compounds suitable for use in radiopharmacy comprising such groupswherein R1 and R2 are each a linear or branched C3 to C10 alkyl group and R3 is selected from (i) —OH or —O−, (ii) a sugar moiety or an amino sugar moiety, (iii) an amino acid moiety or an oligopeptide moiety, (iv) a PEG moiety; and from combinations of two or more of (ii), (iii) and (iv).

Modified red blood cells (RBCs) including one or more surface proteins or lipids covalently linked to a cargo by click chemistry are provided. In some examples, the cargo is a cancer therapeutic agent, an autoimmune antigen, or an antigen of a bacterial or viral agent. Also provided are methods of treating a subject with a disease or disorder with the modified RBCs or methods of treating a subject with a disease or disorder or performing imaging analysis of a subject, including administering to the subject a composition including an azido-modified sugar moiety, thereby generating red blood cells comprising one or more azido-labeled surface proteins and administering to the subject a composition including a cargo for treating or inhibiting the disease or disorder, wherein the cargo is capable of covalently binding to the one or more azido-labeled surface proteins or lipids.

Disclosed are polypeptides and methods of glycosylating the C19 hydroxyl group of AmdeB (i.e., amphotericin B lacking the sugar moiety) comprising contacting AmdeB with a saccharide in the presence of one of the polypeptides. The methods access compounds that are analogues of amphotericin B with a modified sugar moiety that have an improved therapeutic index, such as C2′epiAmB. Also disclosed are pharmaceutical compositions comprising the compounds and a pharmaceutically acceptable carrier.

The present invention provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APP RNA in cells or animals, and, in some cases, for reducing the amount of APP protein in cells or animals. [Solution] The present invention provides an oligomeric compound comprising a modified oligonucleotide having a specific base sequence, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 80% complementary to the isolength portion of the APP nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or feature of a neurodegenerative disease or disorder.

This specification describes polymers containing specific hydroxyl group modifications, as well as related compositions and methods thereof. [Solution] This specification describes polysaccharide polymers comprising sugar moieties (e.g., sugar monomers of formula (I)) modified with hydroxyl modifiers, as well as related compositions, hydrogels, implantable elements, and methods of use thereof.

It relates to a composition, preferably for cleansing and / or removing makeups from keratin materials, comprising: (i) N-acyl alanine and / or salts thereof; (ii) at least one surfactant with at least one sugar moiety; and (iii) at least 2 wt.% of at least one oil, relative to the total weight of the composition. It also relates to a process for cleansing and / or removing makeups from keratin materials, in particular the skin, comprising applying to the keratin materials, in particular the skin, of the composition mentioned above, and rinsing off the composition after an optional period of time.

The present disclosure provides methods of sequencing polynucleotides and compounds, compositions useful for sequencing of polynucleotides. The chemical compounds include nucleotides and their analogs which possess a sugar moiety comprising a cleavable chemical group capping the 3′-OH group and a base that is attached to a detectable label through a cleavable linker comprising a disulfide bond. In addition, the disulfide bond(s) can be cleavable by a reducing reagent. In addition, after the disulfide bond(s) is / are cleaved by the reducing reagent, there is no free thiol group linked to the nucleotides. Examples of chemical compounds according to the present disclosure are shown as Formulae (IV) and (V).

: The present invention provides a DNA aptamer having a length of up to 80 nucleotides, preferably up to 40 nucleotides, and being or containing the sequence: GGGATACAGGGCTXTGTCTATGGTGTGGATGGCGGATACC (SEQ ID NO. 1), wherein X is T or A, and wherein one to three deoxynucleotides may optionally be modified by fluorination, and / or wherein one or more of deoxyguanosines G10, G22 and G31 may optionally be modified by replacing H2´ of the sugar moiety with F, O-methyl, O-methoxyethyl, or by forming a covalent methylene or ethylene bridge between 2'-O and 4'-C, and / or wherein one or more of G10, G22 and G31 may optionally be modified by replacing the hydrogen atom at the C8 carbon atom of the guanine base with bromine atom or with methyl, and / or wherein the phosphodiester linkage may optionally be replaced by phosphorothioate linkage in one or more nucleotides. The DNA aptamers according to the invention are selective FGFR1 inhibitors and are useful in the treatment of skeletal disorders, developmental disorders, and cancers caused by aberrant FGFR1 signaling.