Unlock instant, AI-driven research and patent intelligence for your innovation.

Balsm-pear-seed ribosome inactivated protein and its coding gene and use

A technology of ribosome inactivation and bitter melon seeds, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of low yield, strong dependence on raw materials, unfavorable preparation of immunotoxins, etc.

Inactive Publication Date: 2010-09-08
SHANXI KANGBAO BIOLOGICAL PROD +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Bitter melon contains a variety of ribosome inactivating proteins, such as α-charantin, β-charantin and MAP30, etc. These protein components have been proven to be good anti-tumor and anti-viral active substances, which have attracted widespread attention. But at present, the method of obtaining ribosome-inactivating protein from bitter gourd seeds mainly relies on natural extraction, which has the disadvantages of strong dependence on raw materials and low yield, which is not conducive to the further preparation of immunotoxins. It is relatively easy to obtain highly active ribosome-inactivating proteins, and can effectively prepare a variety of recombinant immunotoxins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Balsm-pear-seed ribosome inactivated protein and its coding gene and use
  • Balsm-pear-seed ribosome inactivated protein and its coding gene and use
  • Balsm-pear-seed ribosome inactivated protein and its coding gene and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1, Acquisition of Momordica charantia seed ribosome-inactivating protein α-Momorcharin gene

[0052] Obtain the coding gene of balsam pear seed ribosome inactivation protein (called α-Momorcharin, also known as α-Momorcharin-Thr155) of the present invention with following method, and concrete process comprises the following steps:

[0053] 1. Extraction of total RNA from bitter gourd seeds

[0054] Put the bitter melon seeds produced in Beijing in a pre-cooled mortar, add liquid nitrogen and quickly grind them into powder, then add TRIzol reagent (Invitrogen Company), then centrifuge at 4°C and 120,000rpm for 10 minutes, take the supernatant, add chloroform, and add the ratio For 200ul chloroform / 1mL TRIzol, shake vigorously for 15-30 seconds, place at room temperature for 3 minutes, then centrifuge at 120,000rpm at 4°C for 15 minutes, take the upper aqueous phase solution, add an equal volume of isopropanol, mix well, and place at room temperature for 10 minute...

Embodiment 2

[0060] Example 2, Expression and Purification of Bitter Gourd Seed Ribosome Inactivating Protein α-Momorcharin

[0061] 1. Construction of recombinant expression vector pET28a(+)-α-MMC-Thr155

[0062] Design the primers of the Momordica charantia seed ribosome-inactivating protein α-Momorcharin cDNA gene that PCR amplification embodiment 1 obtains, and primer sequence is as follows:

[0063] MMC-1 / NdeI F: 5'-GGAGATATA CATATG GATGTTAGCTTTCGTTTG (underlined base is restriction endonuclease Nde I recognition site);

[0064] MMC-1 / NotI R: 5'-GAGT GCGGCCGC TCATTAAATATTTCGTGTGTTTAA (underlined bases are restriction endonuclease Not I recognition sites).

[0065] The recombinant vector pGEM-T-α-Momorcharin carrying the ribosome-inactivating protein α-Momorcharin gene obtained in Example 1 was used as a template, using the high-fidelity polymerase pyrobest (Takara company), in the primer MMC-1 / NdeI PCR Amplification of Ribosome Inactivating Protein from Momordica charantia seeds ...

Embodiment 3

[0071] Example 3. Functional verification experiment of bitter melon seed ribosome inactivating protein α-Momorcharin-Thr155

[0072] Dilute gastric cancer cell SGC7901 in logarithmic growth phase to 1.5×10 4 cells / mL, add to 96-well plate, 200 μl per well (no cells in the first row) at 37°C, 5% CO 2 Incubate overnight (16 hours), dilute α-Momorcharin-Thr155 in a 1:5 gradient in a 96-well plate, so that the concentration of α-Momorcharin-Thr155 is 180000, 36000, 7200, 1440, 288, 57.6, 11.52 and 2.304 nM, the final volume of each well is 200 μl, discard the culture medium, and add the above-mentioned different concentrations of α-Momorcharin-Thr155 respectively (add fresh medium to the first row, and not add α-Momorcharin-Thr155 to the second row), and then incubate at 37°C , 5%CO 2 Incubate for 72 hours at low temperature, discard the medium, add 100 μl crystal violet solution (0.5%), incubate at room temperature for 30min-1h, wash off the dye, air-dry, then add 150μl Sorens...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to a balsam pear seed ribosome inactivating protein(RIP) and its encode gene and application. This protein has one of the undermentioned amino acid residue sequence: (1) SEQ ID NO:1 in the sequence table; (2) carry out substitution, deficiency or addition of protein that possess activity of inhibiting ribosomal protein synthesis to one to ten amino acid residue of SEQ ID NO: 1 amino acid residue sequence in sequence table. This protein possess hereinafter point: (1) notable effect of resisting tumour and virus infection; (2) high security; (3) simple protein expression condition, easy purification. low cost.

Description

technical field [0001] The present invention relates to plant protein and its encoding gene and application, especially relates to a bitter melon seed ribosome inactivation protein and its encoding gene and its anti-tumor and / or virus infection preparation, especially tumor targeting and anti-HIV and hepatitis virus infection application in medicines. Background technique [0002] Ribosome-inactivating protein (RIP) is a kind of toxic protein widely present in the plant kingdom, and is an inhibitor of eukaryotic protein synthesis. It can act on the 28S rRNA on the large subunit of the mammalian ribosome, and produce adenylation, thereby destroying the structure of the ribosome and inhibiting protein translation; meanwhile, RIP is also involved in the regulation of apoptosis. [0003] According to the primary structure of RIP, it can be divided into two types: type I and type II. Type I RIP is composed of one peptide chain; type II RIP is composed of two polypeptide chains,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29A61K38/16A61P35/00A61P31/12
Inventor 孙红琰周满祥申云飞
Owner SHANXI KANGBAO BIOLOGICAL PROD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More