Balsm-pear-seed ribosome inactivated protein and its coding gene and use
A technology of ribosome inactivation and bitter melon seeds, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of low yield, strong dependence on raw materials, unfavorable preparation of immunotoxins, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1, Acquisition of Momordica charantia seed ribosome-inactivating protein α-Momorcharin gene
[0052] Obtain the coding gene of balsam pear seed ribosome inactivation protein (called α-Momorcharin, also known as α-Momorcharin-Thr155) of the present invention with following method, and concrete process comprises the following steps:
[0053] 1. Extraction of total RNA from bitter gourd seeds
[0054] Put the bitter melon seeds produced in Beijing in a pre-cooled mortar, add liquid nitrogen and quickly grind them into powder, then add TRIzol reagent (Invitrogen Company), then centrifuge at 4°C and 120,000rpm for 10 minutes, take the supernatant, add chloroform, and add the ratio For 200ul chloroform / 1mL TRIzol, shake vigorously for 15-30 seconds, place at room temperature for 3 minutes, then centrifuge at 120,000rpm at 4°C for 15 minutes, take the upper aqueous phase solution, add an equal volume of isopropanol, mix well, and place at room temperature for 10 minute...
Embodiment 2
[0060] Example 2, Expression and Purification of Bitter Gourd Seed Ribosome Inactivating Protein α-Momorcharin
[0061] 1. Construction of recombinant expression vector pET28a(+)-α-MMC-Thr155
[0062] Design the primers of the Momordica charantia seed ribosome-inactivating protein α-Momorcharin cDNA gene that PCR amplification embodiment 1 obtains, and primer sequence is as follows:
[0063] MMC-1 / NdeI F: 5'-GGAGATATA CATATG GATGTTAGCTTTCGTTTG (underlined base is restriction endonuclease Nde I recognition site);
[0064] MMC-1 / NotI R: 5'-GAGT GCGGCCGC TCATTAAATATTTCGTGTGTTTAA (underlined bases are restriction endonuclease Not I recognition sites).
[0065] The recombinant vector pGEM-T-α-Momorcharin carrying the ribosome-inactivating protein α-Momorcharin gene obtained in Example 1 was used as a template, using the high-fidelity polymerase pyrobest (Takara company), in the primer MMC-1 / NdeI PCR Amplification of Ribosome Inactivating Protein from Momordica charantia seeds ...
Embodiment 3
[0071] Example 3. Functional verification experiment of bitter melon seed ribosome inactivating protein α-Momorcharin-Thr155
[0072] Dilute gastric cancer cell SGC7901 in logarithmic growth phase to 1.5×10 4 cells / mL, add to 96-well plate, 200 μl per well (no cells in the first row) at 37°C, 5% CO 2 Incubate overnight (16 hours), dilute α-Momorcharin-Thr155 in a 1:5 gradient in a 96-well plate, so that the concentration of α-Momorcharin-Thr155 is 180000, 36000, 7200, 1440, 288, 57.6, 11.52 and 2.304 nM, the final volume of each well is 200 μl, discard the culture medium, and add the above-mentioned different concentrations of α-Momorcharin-Thr155 respectively (add fresh medium to the first row, and not add α-Momorcharin-Thr155 to the second row), and then incubate at 37°C , 5%CO 2 Incubate for 72 hours at low temperature, discard the medium, add 100 μl crystal violet solution (0.5%), incubate at room temperature for 30min-1h, wash off the dye, air-dry, then add 150μl Sorens...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com