Preparation method and application of Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine

A technology of Vibrio harveii and DNA vaccine, applied in the fields of genetic engineering and immunology, can solve the problems of cytotoxicity and low immune protection rate, and achieve the effects of high repetition rate, strong experimental operability and simple preparation method

Inactive Publication Date: 2010-11-10
OCEAN UNIV OF CHINA
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing common DNA vaccines still have disadvantages such as cytotoxicity and low immune protection rate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine
  • Preparation method and application of Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine
  • Preparation method and application of Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1: Preparation of tdh2-oppA fusion gene:

[0053] 1. Preparation of gene tdh2 and gene oppA:

[0054] 1. Preparation of gene tdh2:

[0055] (1) According to the sequence of the thermostable hemolysin subunit gene tdh2 of Vibrio parahaemolyticus included in GeneBank, a pair of primers a for amplifying the gene tdh2 was designed, and its sequence is:

[0056] 5’CGCCTCGAGATGAAGTACCGATATTTTGCA 3’

[0057] 5'CGCGAATTCTTGTTGATGTTTACATTCAAAA 3'

[0058] (2) take the genomic DNA of Vibrio parahaemolyticus as a template, carry out PCR reaction, obtain the PCR product of 570bp;

[0059] The reaction conditions were as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute; this reaction was performed for 30 cycles; and then extension at 72°C for 10 minutes.

[0060] The reaction system is: 5μl Buffer, 3μl MgCl 2 , 0.5 μl of dNTP, 0.5 μl of Taq enzyme, 2 μl of template DNA,...

Embodiment 2

[0081] Example 2: Construction of tdh2-oppA fusion gene eukaryotic expression vector pEGFP-N1-tdh2-oppA:

[0082] 1. prepare the gene tdh2 carrier DNA that has XhoI and EcoRI double restriction site by the method for embodiment 1;

[0083] 2. Digest the eukaryotic expression vector pEGFP-N1 and the gene tdh2 vector DNA with XhoI and EcoRI, and separate to obtain the linear vector pEGFP-N1 and the linear gene tdh2;

[0084] 3. Take 4.5 μl of the linear gene tdh2, add 0.5 μl of the linear vector pEGFP-N1, mix, then add 5 μl of DNA ligase, and react at 16°C for 16 hours to obtain the gene tdh2 ligation product;

[0085] 4. Transform the gene tdh2 ligation product into Escherichia coli DH5α for culture, pick the colony and extract the carrier DNA, after PCR reaction and XhoI, EcoRI double enzyme digestion detection, screen to obtain the engineering vector pEGFP-N1-tdh2;

[0086] 5. Prepare the gene oppA carrier DNA with EcoRI and BamHI double restriction sites by the method of ex...

Embodiment 3

[0092] Example 3: Preparation and use of double DNA subunit vaccine suspension

[0093] Transform the pEGFP-N1-tdh2-oppA engineering vector obtained in Example 2 above into Escherichia coli DH5α, and after culturing in LB liquid medium containing kanamycin for 12-18 hours, extract the engineering vector pEGFP-N1-tdh2 -oppA, after the endotoxin removal treatment was carried out on the carrier, the carrier was dissolved in 0.05mol / L phosphate buffer saline PBS to a concentration of 200 μg / ml, and the double DNA subunit of Vibrio harveyi and Vibrio parahaemolyticus was obtained Unit vaccine suspension.

[0094] The above-mentioned vaccine suspension can be directly immunized to fish. Taking the cultured flounder as an example, the immunization method is as follows: buy the same batch of healthy flounder two weeks before the immunization experiment, raise them in the water tank at room temperature, ventilate and change the water and feed normally; use the prepared engineering car...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method and application of a Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine. The Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine is characterized by being a tdh2-oppA fusion gene protein eukaryotic expression engineering vector vaccine formed by connecting a Vibro harveyi oppA gene with a Vibrio parahaemolyticus tdh2 gene through 6 nucleotides GAATTC. The preparation method comprises the steps of: cloning the tdh2 gene and the oppA gene into a linear vector Pmd19-T Simple; inserting the fusion gene into a eukaryotic expression vector pEGFP-N1 by adopting a double-enzyme cleavage technology to construct a pEGFP-N1-tdh2-oppA fusion gene protein eukaryotic expression engineering vector vaccine; and finally preparing a Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine suspension by using a conventional method, and immunizing fishes by the dosage of 100 microlitres per fish. The invention has strong operability, high repetition rate, safety, no toxic or side effect, double immune protection for fishes and higher immune effect than an inactivated vaccine, a recombinant protein vaccine and a common DNA vaccine.

Description

technical field [0001] The invention belongs to the vaccine and its preparation technology in the field of biotechnology, and relates to genetic engineering and immunology. Specifically, it relates to the preparation method and application of the dual DNA vaccine of Vibrio harveyi and Vibrio parahaemolyticus. Background technique [0002] Both Vibrio harveyi and Vibrio parahaemolyticus are Gram-negative bacteria that are widely distributed in coastal seawater environments and can infect marine fish, prawns, crustaceans and other aquatic animals. It is the main pathogenic bacteria of shrimp and fish cultured in many countries and regions in the world, and it causes great economic losses to the aquaculture industry every year. At the same time, these two bacteria are also the main pathogens of seafood food poisoning and acute diarrhea in coastal areas in summer and autumn. The main pathogenic factors of Vibrio harveyi are oligopeptide binding protein, hemolysin and extracell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K39/106A61P31/04C12N15/62
Inventor陈吉祥刘瑞何庆芳徐广峰
OwnerOCEAN UNIV OF CHINA