Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting ox FTO (Fat Mass and Obesity-associated) gene single nucleotide polymorphism (SNP)

A single nucleotide polymorphism and scalping technology, applied in the field of molecular genetics, can solve problems such as lack of research and achieve low cost effects

Inactive Publication Date: 2010-12-08
NORTHWEST A & F UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there has been no research on the genetic variation of the FTO gene in cattle at home and abroad. Due to the lack of research on the genetic variation of the FTO gene in Chinese cattle,...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting ox FTO (Fat Mass and Obesity-associated) gene single nucleotide polymorphism (SNP)
  • Method for detecting ox FTO (Fat Mass and Obesity-associated) gene single nucleotide polymorphism (SNP)
  • Method for detecting ox FTO (Fat Mass and Obesity-associated) gene single nucleotide polymorphism (SNP)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The present invention utilizes the method of PCR-SSCP to detect the single nucleotide polymorphism that the mutation of the missense codon at the 783rd position of the coding region of the cattle FTO gene may produce a change in the composition of the encoded protein, and the present invention will be further described in detail below , the description is to explain rather than limit the present invention.

[0025] a. Design of PCR primers for the region of the fourth exon in the cattle FTO gene

[0026] Taking the bovine (NC_007316.3) sequence published by NCBI as a reference, Primer 5.0 was used to design PCR primers capable of amplifying the fourth exon region of the cattle FTO gene. The primer sequence P is:

[0027] Upstream primer: gatgaaacattcctgac17;

[0028] Downstream primer: gctttgatccttgcattacc20;

[0029] Using primer P to amplify the cattle genomes from different populations, it can amplify a 201bp gene fragment including the fourth exon region 21470892b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting ox FTO (Fat Mass and Obesity-associated) gene single nucleotide polymorphism (SNP), which comprises the following steps of: carrying out PCR (Polymerase Chain Reaction) amplification on an ox FTO gene by adopting FTO gene-contained ox whole genome DNA to be detected as a template and a primer pair P as a primer; after carrying out high-temperature denaturation on a PCR product, carrying out polyacrylamide gel electrophoresis; and identifying the SNP of the 783rd site (+1 as a translation initiation site) of an ox FTO gene coding area according to a polyacrylamide gel electrophoresis result. Because the FTO gene function involves in body length and body height characters, the detecting method provided by the invention lays the foundation for establishing an SNP and growth character relation of the FTO gene so as to be used for marker-assisted selection (MAS) of growth characters for Chinese beef and rapidly establish an ox population with favorable genetic resources.

Description

technical field [0001] The invention belongs to the field of molecular genetics, relates to the detection of gene single nucleotide polymorphism (SNP), in particular to a method for detecting the single nucleotide polymorphism of cattle FTO gene. Background technique [0002] Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide on the genome, forming genetic markers, and there are many of them. Includes substitutions, transversions, deletions and insertions. Theoretically speaking, a SNP may be a two-allelic polymorphism, or a three- or four-allelic polymorphism, but in practice, the latter two are very rare and can almost be ignored. Therefore, the so-called SNPs are biallelic polymorphisms. This variation may be a transition (C, T, and G, A on its complementary strand) or a transversion (C-A, G-T, C-G, A-T). The incidence of conversion is always significantly higher than that of several other variants, the SNPs with conversion variants acc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 陈宏张宝张良志胡沈荣雷初朝
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com