Method for detecting ox FTO (Fat Mass and Obesity-associated) gene single nucleotide polymorphism (SNP)
A single nucleotide polymorphism and scalping technology, applied in the field of molecular genetics, can solve problems such as lack of research and achieve low cost effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] The present invention utilizes the method of PCR-SSCP to detect the single nucleotide polymorphism that the mutation of the missense codon at the 783rd position of the coding region of the cattle FTO gene may produce a change in the composition of the encoded protein, and the present invention will be further described in detail below , the description is to explain rather than limit the present invention.
[0025] a. Design of PCR primers for the region of the fourth exon in the cattle FTO gene
[0026] Taking the bovine (NC_007316.3) sequence published by NCBI as a reference, Primer 5.0 was used to design PCR primers capable of amplifying the fourth exon region of the cattle FTO gene. The primer sequence P is:
[0027] Upstream primer: gatgaaacattcctgac17;
[0028] Downstream primer: gctttgatccttgcattacc20;
[0029] Using primer P to amplify the cattle genomes from different populations, it can amplify a 201bp gene fragment including the fourth exon region 21470892b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


