Gene-modified peste des petits ruminants N gene and modification method and chemical synthesis thereof
A PPR reaction technology, applied in the field of molecular biology, can solve problems such as difficult synthesis, complex secondary structure, time-consuming and labor-intensive problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Modification of PPRVN protein gene:
[0037] The amino acid synonymous modification was carried out according to the gene sequence of the tibet strain of the NCBI Peste des ruminants virus (Genbank accession number EU360596). The principle of the transformation is to make it suitable for expression in the prokaryotic system, using high-frequency ACC, CTG, CGT, ATC instead of ACA, CTA, AGA, ATA. The Arg codons AGA, AGG, CGG, CGA, Ile codon AUA, Leu codon CUA, Gly codon GGA and Pro codon CCC should be replaced as synonymously as possible. At the same time, considering that the endonuclease site that conflicts with the restriction endonuclease on the multiple cloning site of the expression vector cannot be introduced into the gene, the modified N protein nucleic acid sequence is as SEQ ID NO: 41:
[0038] ATGGCTACTTTATTAAAATCTTTAGCTTTATTTAAACGTAATAAAGATAAAGCTCCTACTGCTTCTGGTTCTGGTGGTGCTATTCGTGGTATTAAAAATG TTATTATTGTTCCTATTCCTGGTGATTCTTCTATTACTACTCGTTCTCGTTTATTAGATCGTT...
Embodiment 2
[0039] Example 2 Synthesis of N gene by PCR
[0040] Material: The N protein nucleic acid sequence comes from the modified gene sequence.
[0041] The primer sequence SEQ ID NO: 1-40 was synthesized by Shanghai Jierui Biological Co., Ltd.
[0042] Kit: PrimeSTAR HS DNA Polymerase Kit (Takara, catalog number DR010A)
[0043] pM D19-T simple vector (Takara, catalog number D104A)
[0044] PCR instrument (S1000 thermal cycler) was purchased from Bio Rad
[0045] Agarose was purchased from GENETECH (SHANGHAI) Co., Ltd. (batch 111760)
[0046] pET-32a is kept by our laboratory
[0047] Bl21(DE3)Plyss (preserved in this laboratory)
[0048] N protein monoclonal antibody is kept by our laboratory
[0049] The secondary antibody is HRP goat anti-mouse IgG antibody (LP1002a) purchased from Abgent Primary Antibody
[0050] Pre-stained protein Marker (SM0671) was purchased from Fermentas
[0051] 1. Primer design
[0052] Primers were designed using the modified gene sequence as a design template. A total...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 