Gene-modified peste des petits ruminants N gene and modification method and chemical synthesis thereof
A technology of Peste des petits ruminants and reaction, applied in the field of molecular biology, can solve problems such as difficult synthesis, time-consuming and labor-intensive, complex secondary structure, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The transformation of embodiment 1 PPRVN protein gene:
[0037] According to the gene sequence of NCBI Peste des petits ruminants virus tibet strain (Genbank accession number EU360596), amino acid synonymous transformation was carried out. The principle of transformation is to make it suitable for expression in prokaryotic system, and replace ACA, CTA, AGA, ATA with ACC, CTG, CGT, ATC with high frequency of use. Arg codons AGA, AGG, CGG, CGA, Ile codon AUA, Leu codon CUA, Gly codon GGA and Pro codon CCC were synonymous substitutions as much as possible. At the same time, considering that the gene cannot introduce an endonuclease site that conflicts with the restriction endonuclease on the multiple cloning site of the expression vector, the modified N protein nucleic acid sequence is as shown in SEQ ID NO: 41:
[0038] ATGGCTACTTTATTAAAATCTTTAGCTTTATTTAAACGTAATAAAGATAAAGCTCCTACTGCTTCTGGTTCTGGTGGTGCTATTCGTGGTATTAAAAATGTTATTATTGTTCCTATTCCTGGTGATTCTTCTATTACTACTCGTTCTCGTTTA...
Embodiment 2
[0039] Example 2 Synthesis of N gene by PCR
[0040] Materials: N protein nucleic acid sequence comes from the modified gene sequence.
[0041] The primer sequence SEQ ID NO: 1-40 was synthesized by Shanghai Jierui Biological Co., Ltd.
[0042] Kit: PrimeSTAR HS DNA Polymerase Kit (Takara, catalog number DR010A)
[0043] pM D19-T simple vector (Takara, catalog number D104A)
[0044] PCR instrument (S1000 thermal cycler) was purchased from Bio Rad company
[0045] Agarose was purchased from GENETECH (SHANGHAI) Co., Ltd. (batch 111760)
[0046] pET-32a is preserved by our laboratory
[0047] Bl21(DE3)Plyss (preserved in this laboratory)
[0048] N protein monoclonal antibody is preserved by our laboratory
[0049] The secondary antibody was HRP goat anti-mouse IgG antibody (LP1002a) purchased from Abgent Primary Antibody Company
[0050] Pre-stained protein Marker (SM0671) was purchased from Fermentas
[0051] 1. Primer Design
[0052] Primers were designed using the mo...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com