Anti-tumor targeting engineering bacteria and bacterial agent and method for preparing bacterial agent
A technology of anti-tumor and engineering bacteria, which is applied in the direction of anti-tumor drugs, biochemical equipment and methods, and methods based on microorganisms. It can solve the problems of normal tissue toxicity, etc., and achieve the effect of short fermentation cycle and simple growth conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1: Example of the construction method of the anti-tumor targeting engineered bacteria of the present invention
[0055] PCR amplified P lac 启动子LacI末端与LacZ前端序列GCGCCCAATACGCAAA CCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT;设计引物,Plac-F: CACCCTCATCAGTGCCAACATAGTAA GCCAGTATACACTCCGCTAGCGCG CGCCCAATACGCAAACCGCCT , the underlined part is the specific primer, and its front sequence is the homology arm; Plac-R: ATTTCTAGAGGATCC CCGGGTACCGAGCTCGAATTCGTA ATCATGGTCATAGCTGTTTC , the underlined part is the specific primer, its front sequence is the homology arm, the pBlueScript KS(+) plasmid is used as the template, and Plac-F / Plac-R is used as the primer to amplify the 311bp truncated P lac For the promoter and homology arm part, the reaction conditions are: pre-denaturation at 94°C for 4 min; denaturation a...
Embodiment 2
[0065] Example 2: Example of the preparation method of the anti-tumor targeting engineered bacterial agent of the present invention
[0066] Process reference Figure 8 :
[0067] (1) Activation of bacteria
[0068] Streak-inoculate the preserved recombinant Escherichia coli LMA1 on the slant of the solid seed medium, and culture it upside down at 37°C for 12 hours; pick a single colony and streak it, and culture it upside down at 37°C for 12 hours for further purification;
[0069] (2) Preparation of fermented seed liquid
[0070] Pick Escherichia coli LMA1 to inoculate into 10ml containing 12.5μg.mL -1 Chloramphenicol in LB medium, 200r.min at 37°C -1 Shake culture for 8h to mid-logarithmic growth, inoculate 10mL of culture solution into 1000mL containing 12.5μg.mL -1 Chloramphenicol LB medium, 200r.min at 37°C -1 Shake culture for 13 hours to obtain the fermentation liquid of the primary seed tank; sterilize the secondary seed tank at 121°C for 30 minutes, put it in...
experiment example 1
[0086] Experimental Example 1: Inhibitory Effect of Gene Recombined Escherichia coli LMA1 Bacterial Agent on the Growth of B16F10 Mice Melanoma
[0087] The purpose of this experiment is to study the inhibitory effect of Escherichia coli LMA1 bacterial agent on the growth of melanoma in B16F10 mice
[0088] Mouse melanoma B16-F10 cells similar to human melanoma were routinely cultured in 1640 medium with 10% FCS in 5% CO2 cultured at 37°C in a cell culture incubator. The cells in the exponential proliferation phase were digested with 0.25% trypsin, collected by centrifugation, washed 3 times with PBS, stained with trypan blue, and the cell suspension was counted, and the cell viability was detected to be over 95%, and finally resuspended to 1×10 cells in PBS. 6 / mL. Forty C57BL / 6 female mice of 6-8 weeks were selected, and 100ul of B16F10 mouse melanoma cells were subcutaneously injected on the right side of the back of the mice. After 6 days, the mice were randomly divided ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| density | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 