Expression gene tag library and differentially expressed genes in different developmental stages of Ostrinia oleifera
A technology of Asian corn borer and labeling, which is applied in the fields of biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of difficult to eliminate redundant sequences, large workload and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1, obtain DGE-tag
[0037] Taking the DGE-tag analysis of the Asian corn borer as an example, the method steps are as follows, and the concise experimental procedure is shown in figure 1 and figure 2 .
[0038] 1. Extraction of total RNA from Ostrinia officinalis
[0039] Extract by conventional Trizol method, purify by conventional method, and treat with DNase to obtain a Total RNA sample with a concentration ≥ 300ng / ul, a total amount ≥ 6ug, and an OD260 / 280 of 1.8-2.2 (must meet the detection requirements of Agilent 2100).
[0040] 2. Isolation of mRNA and synthesis of cDNA
[0041]The mRNA with polyA was isolated using magnetic beads with oligo-dT, and then the first-strand cDNA was synthesized using random 6-mers and Invitrogen's Superscript II reverse transcriptase kit. cDNA second strand was completed with RNase H (Invitrogen) and DNA polymerase I (New England BioLabs).
[0042] 3. Tag preparation and sequencing
[0043] Utilizing the double-str...
Embodiment 2
[0048] Embodiment 2, DGE-tag analysis
[0049] DGE-tag analysis continues with embodiment 1, and proceeds to the following steps:
[0050] (c) Annotate the Tag and establish the corresponding relationship between the Tag and the gene: since there is no reference gene data for Ostrinia oleifera, the inventors refer to the RNA-seq data of Ostrinia strigae that was completed at the same time, and use software to retrieve the RNA-seq data for Ostrinia striatus For all CATG sites in the database, a reference label database of CATG+17nt bases is generated. Then compare all Clean Tags with the reference tag database, allow up to one base mismatch, perform gene annotation on the tag (Unambiguous Tags) that is uniquely compared to a gene, and count the number of original Clean Tags corresponding to each gene, and then Standardize the original Clean Tag numbers to obtain standardized gene expression levels, so as to measure gene expression levels more accurately and scientifically. Th...
Embodiment 3
[0056] Embodiment 3, DGE-tag analysis result
[0057] Using the method of the present invention, 320,985 Tag-seq sequences of the four developmental stages of O. corn borer eggs, larvae, pupae, and adults were obtained; the number of tags annotated in the four developmental stages were 31,504, 33,081, 33,340, and 37,352, respectively. Using the method of the present invention, after functionally annotating all DGE-tags of Ostrinia officinalis, a total of 35,779 functional genes were annotated, including 8,415 functions at the egg stage, 7,988 at the larval stage, 9,123 at the pupal stage, and 10,253 at the adult stage Gene.
[0058] Table 1 lists several Tag-seq sequences and their expression levels in four developmental stages.
[0059] Table 1. Tag-seq with more than 10,000 expressions in a certain period
[0060] Tag-seq egg stage Larval stage Pupal stage adult stage CATGGACTCCGCCGAGGGAGA (SEQ ID NO: 1) 21200 15301 8776 4798 CATGTGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More