9 results about "Wild species" patented technology

The invention discloses a thrip resistance identification device and application. The device comprises an inoculation barrel, a preservation substrate is laid at the bottom in the inoculation barrel, an isolation structure with one or more through holes covers the preservation substrate, and a sealing structure with one or more air holes covers an opening in the top of the inoculation barrel. When the device is used, the whole plant does not need to be cultivated, in-vitro flowering branches can be picked for identification, rapid screening of large-scale germplasm resources can be achieved, and repeatability and consistency of experimental results are good. Meanwhile, when the device is used, buds and functional leaves of in-vitro flowering branches are reserved, the actual feeding part of the Frankliniella occidentalis is simulated, and compared with in-vitro leaf inoculation, the real resistance level can be better reflected. The device has the advantages of easily available materials, low cost and strong operability, can be used for identifying the resistance of the Frankliniella occidentalis of various materials such as chrysanthemum and related wild species, cultivated species, breeding offspring and the like, provides a high-quality parent material for insect-resistant breeding, can be used for researching an insect-resistant mechanism, and is suitable for popularization and application in basic breeding units.

The invention relates to the technical field of crop molecular breeding and biology, and discloses a sorghum whole genome 24K-SNP liquid chip and application thereof.The chip obtains 24062 SNP loci through process screening on the basis of whole genome re-sequencing data of global sorghum germplasm, and screening standards include that variation with the minimum allele frequency larger than 0.01 is reserved; it is ensured that the site flanking 100bp sequence is uniquely compared in a reference genome, and the consistency reaches 100%; removing redundant variation within 30bp at the downstream of the site; and implementing a distribution strategy that 6-7 sites are reserved in each 100Kb interval, a coding region is anchored preferentially, and a centromere region is filled. According to the method, the specific probe is used for liquid-phase hybrid capture, so that the method has the advantages of wide genetic background coverage, high capture specificity, uniform genome coverage and the like, can effectively solve the genetic typing problem of wild species and different-place germplasm, and is widely applicable to sorghum germplasm resource identification, whole-genome association analysis and molecular breeding research.

The invention relates to the technical field of vegetative propagation of plants, and particularly discloses a method for promoting growth of a peony high-altitude layering propagation root system by using a humic acid-rich fertilizer solution, and the method adopts a humic acid-containing water-soluble fertilizer to promote rooting. In order to solve the problems of low propagation coefficient, complicated operation, high labor cost and the like of a traditional peony propagation method, especially a high-altitude layering propagation method, and the risk of hormone rooting agent residue, a humic acid-containing water-soluble fertilizer is innovatively adopted as a root promoting agent to smear girdling cuts below mixed buds to promote rooting. The method solves the technical bottlenecks of few induced root systems and slow growth in high-altitude layering propagation of the peony, is suitable for commercial seedling culture of the peony, protection of endangered wild species, propagation of hybrid superior plants and the like, and provides technical support for efficient propagation of the peony.

The invention relates to a design and use method of a specific probe library for accurately identifying wild species chromosomes in peanut interspecific hybrids, which specifically comprises the following steps: assembling a T2T reference genome of a peanut related wild species Zw61, then carrying out bioinformatics analysis on the genome sequence and published Tifrunner, YZ9102, A. duranensis and A. ipaensis reference genomes, and finally identifying the chromosomes of the wild species in the peanut interspecific hybrids. An oligonucleotide library containing 91500 cultivated species and Zw61 variation group sequences is obtained, the oligonucleotide library comprises 10 oligonucleotide pools corresponding to chromosomes 1-10 of Zw61, the oligonucleotide library can be used for accurately identifying artificially synthesized hexaploid F1 of the cultivated species and the wild species and exogenous chromosomes in hybrid progenies through single-chromosome coating, and the identity of the exogenous chromosomes can be accurately determined; the problem that peanut distant hybridization exogenous chromosomes are difficult to identify is solved, and particularly the identification problem of exogenous chromosomes which are very close to cultivated species in genetic relationship and high in chromosome homology is solved.

The invention discloses a salt tolerance related SSR sequence derived from cotton diploid wild species abnormal cotton and application thereof, the SSR sequence belongs to a specific DNA fragment of an abnormal cotton introgression line CSSL44, and is located on a No.6 chromosome of an abnormal cotton chromosome group. The specific DNA fragment provided by the invention has an important application value in salt-tolerant cotton breeding, meanwhile, the 9 pairs of SSR molecular markers developed by the invention provide a molecular basis for cultivating salt-tolerant cotton varieties which can be applied to production, and by utilizing the molecular markers provided by the invention, the salt-tolerant character of a cotton plant can be quickly identified, and the application prospect is wide. And a technical foundation is laid for research on a cotton salt tolerance improving mechanism.

The application discloses a method for delaying the flowering of a wild sugarcane variety to realize hybridization with a cultivated variety, which comprises the following steps: firstly, determining the germplasm of the wild sugarcane variety (commonly known as the Qushenmi variety), and determining the type of the selected germplasm according to the breeding target before utilization; secondly, delaying the cultivation of the selected Qushenmi variety, that is, taking the seed stalks from a seedling nursery in early June to mid-July to perform the delaying cultivation, and cutting off the main stem in early or middle September, and focusing on cultivating the tiller stems until the Qushenmi variety flowers; and finally, processing the field difficult-to-flower sugarcane parent plants in the parent generation, such as the tropical variety, the sugarcane breeding variety or the parent plant, cultivating the parent plants by means of barrel cultivation, starting to induce the flowering of the parent plants by means of artificial light period on about June 20, realizing the flowering period of the Qushenmi variety, performing the warm water emasculation treatment on the inflorescence of the female parent, and then performing the parent combination, so that the hybridization utilization of the excellent Qushenmi variety can be realized.

The present application belongs to the technical field of molecular biology, and particularly relates to a SNP molecular marker combination for identifying or distinguishing almond germplasm resources, a liquid phase chip and application. The SNP molecular marker combination is a combination of 24 SNP loci, or a combination of 5174 SNP loci containing the 24 SNP loci, and the specific position information is shown in Table 6 and Table 3 of the specification in turn. Based on the combination of 24 SNP loci, the specific variety of an almond sample can be accurately identified. Based on the combination of 5174 SNP loci, through simple population genetic diversity analysis, the Mediterranean strain almond variety, the Central Asian strain almond variety, the wild species or relative species almond variety and the almond variety between the wild species and the cultivated species can be quickly and accurately distinguished, which has important significance in the protection and utilization of almond germplasm resources and the genetic breeding of almond. The primer, probe or chip developed based on the SNP molecular marker combination is simple, efficient and highly accurate.

The invention relates to the technical field of sweet potato breeding, in particular to a method for creating tetraploid and pentaploid new germplasm containing wild germplasm Xu potato 18, which comprises the following steps: by taking a hexaploid sweet potato variety Xu potato 18 (2n = 6x = 90) as a female parent and a diploid related wild variety Ipomoea trifida (2n = 2x = 30) as a male parent, carrying out Brazil morning glory grafting and short-day treatment to induce flowering, and then controlling pollination hybridization to obtain a tetraploid hybrid F1; backcrossing the tetraploid serving as a female parent with Xu potato 18 to obtain a pentaploid new germplasm; chromosome ploidy is identified through a cytological method, hybrid authenticity is verified through SSR molecular markers, and new germplasm characteristics are analyzed and evaluated in combination with phenotypic character investigation and rooting characteristic analysis; the novel pentaploid germplasm carrying exogenous genetic materials is successfully created, the genetic background of sweet potato cultivated varieties is effectively widened, valuable bridge germplasm is provided, and a reliable technical scheme and germplasm support are provided for sweet potato variety improvement and excavation and utilization of excellent genes of related wild species.

The application provides a potato direct cold resistance related Indel molecular marker and application. The potato direct cold resistance related Indel molecular marker, which is named Indel0516 in full name, comprises an upstream primer sequence Indel0516-F: TTAGCAATGGAACGAGTTCA and a downstream primer sequence Indel0516-R: ACGTGCATTAGGAGTCATTT. The application crosses two strains CND50-2 (PI 473493) and CND48-2 (PI 473345) of a potato diploid wild species S. candolleanum, constructs a direct cold resistance segregation population, and obtains an Indel molecular marker significantly associated with the direct cold resistance of the potato wild species S. candolleanum by using QTL-seq and combining molecular marker development. CND50-2 is a cold resistance strain of S. candolleanum, and CND48-2 is a low-temperature sensitive strain of S. candolleanum. The Indel molecular marker significantly associated with the direct cold resistance is used to detect germplasm resources with S. candolleanum cold resistance strain blood relationship, and it is found that the detection of the direct cold resistance of the offspring is more accurate, which indicates that the molecular marker can be applied to the assisted selection of the direct cold resistance of S. candolleanum.