Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel method for inhibiting primary liver cancer growth and metastasis

A technology for inhibiting and treating liver cancer, which is applied in the fields of pharmaceutical formulations, gene therapy, and genetic material components, and can solve problems such as high drug resistance to chemotherapy and difficult treatment of liver cancer

Active Publication Date: 2014-06-04
GENERAL HOSPITAL OF PLA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to solve the current problems of difficult treatment of primary liver cancer and high drug resistance to chemotherapy, and to provide a new method for targeted treatment of liver cancer. The method uses miRNA-885- 5p as a target to treat tumors with miRNA agonists including miRNA-885-5p mimics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel method for inhibiting primary liver cancer growth and metastasis
  • Novel method for inhibiting primary liver cancer growth and metastasis
  • Novel method for inhibiting primary liver cancer growth and metastasis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 miR-885-5p mimics inhibit the growth of subcutaneous tumors in NOD / SCID mice

[0020] (1) Digest well-grown wild-type human liver cancer SK-Hep-1 cells with trypsin, wash once with PBS and resuspend with DMEM basic medium to 1×10 8 cells / 4ml;

[0021] (2) Subcutaneously inject 200 μl of the treated cells in (1) into the right back of 5-6-week-old NOD / SCID male mice. After 10 days, tumors can be seen on the right back of the mice, and subcutaneous tumors can be formed in NOD / SCID mice. The model is built;

[0022] (3) Intratumoral injection of miR-885-5p mimic 2nM / 100μl, 2 times / week. Injected 6 times, and tracked the tumor volume. Among them, the miR-885-5p mimic was purchased from Guangzhou Ruibo Biotechnology Co., Ltd., and its specific name is miR-885-5p agomir, which contains double-stranded RNA, and the specific sequence of the sense strand of the double-stranded RNA is: 5'UCCAUUACACUACCUGCCUCU3' , the specific sequence of the antisense strand is: 5'A...

Embodiment 2

[0023] Example 2 miR-885-5p inhibits the metastasis of liver cancer

[0024] (1) Establishment of liver cancer stable cell lines with tracer effect

[0025] Plate six-well plates with 293T cells at a density of 1.5×10 6Cells / well for transfection; use lipo-2000 to transfect the lentiviral expression plasmid and lentiviral packaging plasmid containing the luciferase gene (the lentiviral expression system was purchased from Biosettia, USA) into the 293T plated the day before Cells; 16 hours after transfection, fresh DMEM medium was replaced, and the virus supernatant was collected 24 hours after the medium change, and stored in a -80°C refrigerator for later use; human liver cancer HCCLM3 cells were used to spread six-well plates at a density of 1×10 5 Cells / well, used for virus infection; after the virus supernatant is thawed at room temperature, mix 2 ml of full medium without antibiotics and 1 ml of virus supernatant into the HCCLM3 cell well, and add the cationic polymer ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel biotherapy method for inhibiting primary liver cancer growth and metastasis. According to the method, miRNA-885-5p is adopted as a target point, a synthesized miRNA-885-5p stimulant is injected intratumorally, such that the growth of liver tumor is inhibited.

Description

technical field [0001] The present invention relates to a method for treating liver cancer. In the method, miRNA-885-5p, which can inhibit the growth and metastasis of liver cancer, is used as a target to treat liver cancer, and a synthetic miRNA-885-5p mimic (miRNA-885-5p Agomir) to achieve therapeutic effect. Background technique [0002] Primary hepatocellular carcinoma is a common malignant tumor of the digestive tract and ranks fifth in the world. About 6.35 million new cases of malignant tumors are discovered in the world every year, of which liver cancer accounts for about 260,000 cases and 260,000 cases 42.5% of them occurred in our country and the incidence rate is still increasing year by year. Liver cancer is generally found at an advanced stage, and the effective treatment methods are liver resection and liver transplantation. Conventional chemotherapy has no obvious effect on the treatment of liver cancer. Therefore, early diagnosis of liver cancer is particula...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00A61P35/00
Inventor 田亚平张竹红
Owner GENERAL HOSPITAL OF PLA