miRNA (micro Ribonucleic Acid) absorption carrier, preparation method and uses thereof

A carrier, lentiviral carrier technology, applied in the field of construction of new miRNA absorption carrier

Inactive Publication Date: 2012-12-26
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] However, transgenic vertebrates expressing miRNA uptake sequences have not been reported in the literature. If the function of corresponding miRNA can be knocked down in mice through miRNA uptake vectors, it will provide a more convenient tool for miRNA in vivo research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNA (micro Ribonucleic Acid) absorption carrier, preparation method and uses thereof
  • miRNA (micro Ribonucleic Acid) absorption carrier, preparation method and uses thereof
  • miRNA (micro Ribonucleic Acid) absorption carrier, preparation method and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0087] Preparation of transgenic mice with miRNA uptake vector

[0088] The invention provides a transgenic mouse that widely and highly expresses miRNA uptake sequences in vivo through transgenic technology. Transgenic mice are an effective strategy for studying the function of miRNA in vivo, and the transgenic mice provided by the present invention have achieved the function inhibition of endogenous miRNA, which is closer to studying the function of target miRNA at physiological concentrations, and the experimental results are significantly better than those of miRNA in vivo. Highly expressive model.

[0089] The method of the present invention comprises: providing a miRNA absorption carrier; microinjecting mouse fertilized eggs with the miRNA absorption carrier, and transplanting them into the fallopian tubes of pseudopregnant mother mice; after the mother mice give birth to mice, test and obtain the transgene Positive mice; optionally the transgene positive mice are pai...

Embodiment 1

[0113] Embodiment 1: Design and preparation of pGS29 vector

[0114] The restriction endonucleases, Taq enzymes and pMD19-T vectors used in this experiment were purchased from Takara Company.

[0115]

[0116] The miR-29 sponge insert containing 7 repeats ( figure 1 A-B) obtained after PCR reaction with the following two chemically synthesized fragments:

[0117] Fragment 1 (SEQ ID NO: 1):

[0118] 5'-TAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTA-3';

[0119] Fragment 2 (SEQ ID NO: 2):

[0120] 5'-TAGCACCAAGAAAATCGGTTATAGCACCAAGAAAATCGGTTATAGCACCAAGAAAATCGGTTATAGCACCAAGAAAATCGGTTATAGCA-3'

[0121] The resulting miR-29sponge insertion fragment has a total of 147 bp, and its sequence (SEQ ID NO: 3) is as follows:

[0122] TAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTATAACCGATTTTCTTGGTGCTA

[0123] The reaction system was: add 2 μl of 100 μM Fragment 1...

Embodiment 2

[0166] Example 2: Reporter gene experiments in HEK293T cells verify the function of the pGS29 vector

[0167] The restriction endonuclease used in this experiment and the high-fidelity enzyme PrimerSTAR were purchased from Takara Company.

[0168] The PGL3-promoter vector was purchased from Promega (Cat no.E1761); the pMIR-reporter luciferase vector was purchased from Ambion (Cat no.AM5795).

[0169]

[0170] Amplify the full-length 3'UTR sequence of the human TTP gene (Pubmed Gene ID: 7538), digest it with Xba I and insert it into the PGL3-promoter vector after the same digestion, and successfully construct the hTTP 3'UTR reporter gene vector after sequencing verification .

[0171]

[0172] The miR-29 binding site "5'-TGGTGCT-3'" in the hTTP 3'UTR reporter gene vector was mutated into "5'-TCGAGGT-3'" (recombinant PCR site-directed mutagenesis method, that is, designing The primers amplify the upper and lower ends of the product and then anneal), so that it cannot b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an miRNA (micro Ribonucleic Acid) absorption carrier, a preparation method and uses thereof. The miRNA absorption carrier carries expression cassettes 5' to 3' sequentially comprising the following elements: a) an II-type promoter; (b) an indication protein coding sequence; (c) an absorption sequence of target miRNA; and (d) an optional enhancer sequence. The invention also provides a lentiviral particle containing the absorption carrier, a transgenic animal and preparation methods thereof. The miRNA absorption carrier provided by the invention can effectively down-regulate the function of the corresponding family miRNA, plays a role similar to gene subtraction in cells or in vivo, and has broad application prospects.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a construction method and application of a novel miRNA absorption carrier. Background technique [0002] MicroRNA (miRNA) is about 20-24nt long, non-coding microRNA, through which its seed region is partially complementary to the 3'UTR region of the target gene mRNA to mediate the post-transcriptional regulation of about 30% of mammalian genes (Lewis, B.P. et al. , Cell. 2005, 120:15-20). [0003] MiRNAs are involved in the regulation of many key steps in life processes, including differentiation, apoptosis, proliferation and maintenance of specific tissues or cells. In addition, dysregulation of miRNA expression levels is also closely related to tumors and other diseases [Lu, J. et al., Nature.2005, 435: 834-838; Li, Q.J. et al., Cell. Neuron.2007, 54:813-829; Chang, T.C. et al., Mol Cell.2007, 26:745-752; He, L. et al., Nature.2005, 435:828-833; Care, A. et al., Nat Med .2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/867A01K67/027A61K48/00A61P31/04A61P31/06A61P29/00A61P35/00
Inventor 曹雪涛马烽李楠徐胜
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap