Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid
A Streptococcus nucleic acid, Streptococcus pneumoniae technology, applied in microorganisms, microorganism-based methods, biochemical equipment and methods, etc., can solve problems affecting the accuracy of experimental results, nucleic acid amplification technology pollution, affecting the accuracy of identification, etc. , to achieve the effect of preventing false negative and false positive results, high sensitivity, and improving specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1. A kind of primer and fluorescent probe for quantitative detection of Streptococcus pneumoniae nucleic acid
[0042] (1) Design and synthesis of primers and fluorescent probes:
[0043] The Streptococcus pneumoniae specific conserved gene lytA gene was selected as the target detection gene, and the Streptococcus pneumoniae gene was obtained through the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov). There are currently 92 genotypes of Streptococcus pneumoniae lytA gene sequences in cocci, and the lytA gene sequences of 92 genotypes are compared online (http: / / www.ebi.ac.uk / ). Select a conserved sequence in the region, which is shown in SEQ ID NO. 4 in the sequence table: GCCTCAAGTCGGCGTGCAACCATATAGGCAAGTACACGCACACTCAACTGGGAATCCGCATTCAACCGTACAGAATGAAGCGGATTATCACTGGCGGAAAGACCCAGAATTAGGTTTTTTCTCGCACATTGTTGGGAACGGTTGCATCAT, the professional design software BeaconDesigner7.0 of real-time TaqMan fluorescent quantitative PCR is ...
Embodiment 2
[0058] Embodiment 2. A kind of nucleic acid quantitative detection kit for Streptococcus pneumoniae
[0059] The kit for quantitative detection of Streptococcus pneumoniae nucleic acid prepared according to the technical solution provided by the content of the present invention contains the following reagents:
[0060] 1. PCR reaction solution: The proportions of the components in the PCR reaction solution are: 0.3 μL of Taq enzyme with a concentration of 5 U / μL; 2 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; MgCl with a concentration of 25 mmol / L 2 5 μL of solution; 2.5 μL of group A Streptococcus pneumoniae forward primer described in Example 1 with a concentration of 10 μmol / L; 2.5 μL of group A Streptococcus pneumoniae reverse primer with a concentration of 10 μmol / L; A group with a concentration of 10 μmol / L Streptococcus pneumoniae probe 2.5 μL; add sterile water to a volume of 49.5 μL. in:
[0061] The sequence of group A Streptococcus pneumon...
Embodiment 3
[0096] Example 3. Detection of Streptococcus pneumoniae nucleic acid in samples with the kit provided in this example
[0097] Among the reagents included in the kit provided in this example, except for the PCR reaction solution and DNA extraction solution as described below, the composition of the remaining negative quality control products, positive quality control products, borderline positive quality control products, and working standards , the ratio and preparation method are the same as those of the test kit described in Example 2:
[0098] (1) The proportions of the components in the PCR reaction solution are: 0.1 μL of Taq enzyme with a concentration of 5 U / μL; 1 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; MgCl with a concentration of 25 mmol / L 2 3 μL of solution; 0.25 μL of group A Streptococcus pneumoniae forward primer described in Example 1 with a concentration of 10 μmol / L; 0.25 μL of group A Streptococcus pneumoniae reverse primer with ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 