Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid

A Streptococcus nucleic acid, Streptococcus pneumoniae technology, applied in microorganisms, microorganism-based methods, biochemical equipment and methods, etc., can solve problems affecting the accuracy of experimental results, nucleic acid amplification technology pollution, affecting the accuracy of identification, etc. , to achieve the effect of preventing false negative and false positive results, high sensitivity, and improving specificity

Active Publication Date: 2014-01-01
WUHAN BIOTECH GENE ENG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there are still deficiencies in the above methods: using traditional culture methods (national standard method), latex agglutination method, immunochromatography and nucleic acid amplification technology detection, there will be false positive or false negative results, which will affect the accuracy of the experimental results Automated method Because the automatic identification system identifies bacteria according to the background information provided in the database, the incompleteness of the database information will directly affect the accuracy of identification, and there is currently no identification system that can include all detailed identification information; nucleic acid amplification Although the results of the amplification technology are better than the above four methods, the PCR amplification products need to be post-processed, and the contamination of the PCR products during the post-processing will still lead to false positive results, and will pollute the environment and have potential risks to the experimenters. Harm: Although real-time fluorescent quantitative PCR technology solves the problem of nucleic acid amplification technology pollution, and the detection results are more specific than nucleic acid amplification technology, it still cannot achieve 100% specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid
  • Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid
  • Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1. A kind of primer and fluorescent probe for quantitative detection of Streptococcus pneumoniae nucleic acid

[0042] (1) Design and synthesis of primers and fluorescent probes:

[0043] The Streptococcus pneumoniae specific conserved gene lytA gene was selected as the target detection gene, and the Streptococcus pneumoniae gene was obtained through the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov). There are currently 92 genotypes of Streptococcus pneumoniae lytA gene sequences in cocci, and the lytA gene sequences of 92 genotypes are compared online (http: / / www.ebi.ac.uk / ). Select a conserved sequence in the region, which is shown in SEQ ID NO. 4 in the sequence table: GCCTCAAGTCGGCGTGCAACCATATAGGCAAGTACACGCACACTCAACTGGGAATCCGCATTCAACCGTACAGAATGAAGCGGATTATCACTGGCGGAAAGACCCAGAATTAGGTTTTTTCTCGCACATTGTTGGGAACGGTTGCATCAT, the professional design software BeaconDesigner7.0 of real-time TaqMan fluorescent quantitative PCR is ...

Embodiment 2

[0058] Embodiment 2. A kind of nucleic acid quantitative detection kit for Streptococcus pneumoniae

[0059] The kit for quantitative detection of Streptococcus pneumoniae nucleic acid prepared according to the technical solution provided by the content of the present invention contains the following reagents:

[0060] 1. PCR reaction solution: The proportions of the components in the PCR reaction solution are: 0.3 μL of Taq enzyme with a concentration of 5 U / μL; 2 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; MgCl with a concentration of 25 mmol / L 2 5 μL of solution; 2.5 μL of group A Streptococcus pneumoniae forward primer described in Example 1 with a concentration of 10 μmol / L; 2.5 μL of group A Streptococcus pneumoniae reverse primer with a concentration of 10 μmol / L; A group with a concentration of 10 μmol / L Streptococcus pneumoniae probe 2.5 μL; add sterile water to a volume of 49.5 μL. in:

[0061] The sequence of group A Streptococcus pneumon...

Embodiment 3

[0096] Example 3. Detection of Streptococcus pneumoniae nucleic acid in samples with the kit provided in this example

[0097] Among the reagents included in the kit provided in this example, except for the PCR reaction solution and DNA extraction solution as described below, the composition of the remaining negative quality control products, positive quality control products, borderline positive quality control products, and working standards , the ratio and preparation method are the same as those of the test kit described in Example 2:

[0098] (1) The proportions of the components in the PCR reaction solution are: 0.1 μL of Taq enzyme with a concentration of 5 U / μL; 1 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; MgCl with a concentration of 25 mmol / L 2 3 μL of solution; 0.25 μL of group A Streptococcus pneumoniae forward primer described in Example 1 with a concentration of 10 μmol / L; 0.25 μL of group A Streptococcus pneumoniae reverse primer with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer, a fluorescence probe and a kit for the quantitative detection of streptococcus pneumonia nucleic acid and a detection method of streptococcus pneumonia nucleic acid, wherein the primer comprises a forward primer and a backward primer; and the kit is used for the quantitative detection of streptococcus pneumonia nucleic acid and comprises the primer and the fluorescence probe, and PCR reaction liquid, a DNA extraction solution, a negative quality control material, a positive quality control material, a critical positive quality control material and a working standard. The method for the quantitative detection of streptococcus pneumonia nucleic acid through using the primer, the fluorescence probe and the kid comprises the following steps: step 1, sample collection; step 2, sample processing; step 3, sample application; step 4, PCR amplification; and step 5, analysis and judgment. According to the real-time TaqMan fluorescence quantitative PCR provided by the embodiment of the invention, the primer and the fluorescence probe have high specificity and high sensitivity, the kit has precise quantification, and the detection method can rapidly detect the streptococcus pneumonia.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a nucleic acid quantitative detection primer, a fluorescent probe and a kit thereof for Streptococcus pneumoniae. Background technique [0002] Streptococcus pneumoniae (Streptococcus pneumoniae, SP) belongs to the Streptococcus family Streptococcus bacteria, Gram-positive. It does not produce endotoxin and exotoxin, and its pathogenicity is mainly due to the invasion of the capsule: the non-encapsulated variant is non-virulent, and the encapsulated pneumococcus can resist the phagocytosis of phagocytes, which is conducive to the colonization of bacteria in the host. and reproduce. Streptococcus pneumoniae can be divided into more than 90 serotypes according to the polysaccharide antigenicity of the bacterial capsule, and different serotypes have different pathogenicity. [0003] 75% of adults with Streptococcus pneumoniae pneumonia and more than 50% of severe Stre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/46
Inventor 唐景峰罗虹王业富
Owner WUHAN BIOTECH GENE ENG