Aptamer capable of simultaneously identifying OdDHL ([N-(3-oxododecanoyl)-L-homoserine lactone]) and BHL (N-butanoyl-L-homoserine lactone) and application thereof
A nucleic acid aptamer, nucleotide sequence technology, applied in the direction of recombinant DNA technology, DNA/RNA fragments, antibacterial drugs, etc., can solve the problems of QS system activation, allergic reaction, time-consuming and other problems that cannot completely block PA. Good clinical application prospect, simple production process, stable physical and chemical properties
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0047] Example: A compound that can simultaneously recognize N-(3-oxododecanoyl)-L-homoserine lactone (N-(3-oxododecanoyl)-L-homoserine lactone, OdDHL) and N-butyryl homoserine The nucleotide sequence of the nucleic acid aptamer of ester (N-butanoyl-L-homoserine lactone, BHL) is: GCAATGGTACGGTACTTCCTGTGGGTTAGTTTGACTCAAGGCTGGGCTTATACAAAAGTGCACGCTACTTTGCTAA (SEQ ID NO: 1).
[0048] The screening method of described nucleic acid aptamer:
[0049] 1. Main reagents and buffers:
[0050] 1.1 OdDHL analogs (OdDHL surrogates, OdDHLS)
[0051] The OdDHLS selected in the present invention is: 7-oxo-7-[[(3S)-2-oxo-3-pyrrolidinyl] amino]-Heptanoic acid, which was synthesized by Shanghai Kesheng Pharmaceutical Research and Development Co., Ltd. OdDHL and BHL were purchased from sigma-aldrich. The chemical formula of OdDHLS is as follows:
[0052]
PUM
Property | Measurement | Unit |
---|---|---|
affinity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap