Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene

A technology of technical control and fertility genes, applied in the field of plant fertility genes, can solve the problems of low efficiency, no discovery of ABCG15, single population genetic type and trait performance, etc., and achieve labor saving, effective methods, and expansion of germplasm base Effect

Inactive Publication Date: 2014-07-23
SICHUAN AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main problems of rice recurrent selective breeding using the existing rice recessive male sterility are: (1) The overall traits of the population are greatly affected by the genetic background of the recessive male sterility gene donor material, which may easily lead to genetic changes in the population. The types and traits are single, and it is difficult to breed excellent strains; (2) The selection or elimination of strains with recessive sterility genes is based on the natural separation of offspring, which is time-consuming, heavy workload, and low efficiency
Trends in Plant Science 2008.13 (14):151-159), no report on the use of ABCG15 in rice male sterility was found after searching

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene
  • Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene
  • Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Fine Mapping of the Single Recessive Genic Sterility Gene of the Present Invention

[0053] (1) Using two sequenced parents 9311 and Nipponbare with large genetic differences and H 2 S hybridization to construct the positioning population.

[0054] (2) Using H 2 SSR primers and Indel (insertion-deletion) markers with polymorphism between S and 9311 and Nipponbare, in H 2 S×9311 combination F 2 Among the 1200 recessive sterile individual plants, and H 2 S×Nippon Clear F 2 Among the 1320 recessive sterile plants, the linkage relationship between the polymorphic markers Indel40520 and RM20366 between the parents and the sterility gene was analyzed.

[0055] (3) Position the gene controlling the male sterility at a distance of 45K between Indel40520 and RM20366 (see figure 1 ). Indel40520 labeled primer sequence is:

[0056] Indel40520F: TTGGTCCCACAAATAAGTCATG (SEQ ID No: 6),

[0057] Indel40520R: TTGGAGCAACTGAAGCAAGGAA (SEQ ID No: 7);

[0058] The gene...

Embodiment 2

[0059] Example 2 Cloning and Identification of Rice Single Recessive Genic Sterility Gene of the Present Invention

[0060] According to the gene mapping results in Example 1, the Loc_OS06g40550 gene was used as a candidate gene for sequencing analysis. with H 2 S genome DNA is used as a template, and CDS40550-F and CDS40550-R are used as primers for PCR amplification, and the sequencing primers are:

[0061] CDS40550-F: CACCATGATGGAGATCAGCAGCAAT (SEQ ID No: 8),

[0062] CDS40550-R: CTACAAGGGCATGAGGCTGAT (SEQ ID No: 9);

[0063] Described PCR reaction system is: H 2 S genomic DNA 3 μL (200ng), dNTP (2mM) 5 μL, 10XPCR buffer 5 μL, 25mM Mg 2+ 2 μL, primer 10 μM 1.5 μL; KOD-plus-NEO enzyme (1U / μL) 1.5 μL; DMSO 1.5 μL (provided by TOYOBO); H 2 O 30.5 μL. The reaction conditions of the PCR are: 94°C for 2min; 98°C for 10s, 68°C for 1:30min, 35 cycles; 68°C for 10min, 10°C for 1min. Recover the PCR product (refer to the Omega recovery kit manual for the method), and connect ...

Embodiment 3

[0068] Example 3 Complementary transgene verification test

[0069] Proceed as follows:

[0070] 1 Construction of complementary expression vectors:

[0071] In order to verify H 2 Whether the S male sterile material is caused by the deletion of 12bp in ABCG15, the complementary transgene verification experiment was carried out. The construction method of the complementary expression vector is as follows:

[0072] 1.1 Take the normal fertile wild type (H 2 SW) Genomic DNA extracted from plant leaves was used as a template, and Q51 and Q52 were used as primers for PCR amplification; the primers were:

[0073] Q51: CCGGAATTCTGAATCGTCGTCACCTGCTAAGCCCAAAT (SEQ ID No: 12),

[0074] Q52: CGGGGTACCGTGTCCCTCCCTACCCAACCTAACCCAAC (SEQ ID No: 13);

[0075] The PCR reaction system is: Genomic DNA 3μL (200ng), dNTP (2mM) 5μL, 10xPCR buffer 5μL, 25mM Mg 2+2 μL, primer 10 μM 1.5 μL; KOD-plus-NEO (1U / μL) 1.5 μL; DMSO 1.5 μL (provided by TOYOBO); H 2 O 30.5 μL. The reaction conditions...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining a rice sterile line by utilizing an RNAi (Ribose Nucleic Acid interfere) technology to control an expression of a rice fertile gene. The method comprises the following steps of: amplifying a DNA (Deoxyribose Nucleic Acid) fragment used for generating an antisense RNA (Ribose Nucleic Acid); then constructing an expression vector; converting the DNA fragment into normal fertile rice, thereby obtaining a novel rice kernel sterile material. The provided method for generating the kernel sterile line is simple, convenient and rapid. The obtained nuclear sterile material can be used for replacing artificial emasculation during a rice hybridization process, so that the human source is saved; or the obtained nuclear sterile material can be applied to recurrent selection breeding, so that the an important function for amplifying the rice germplasm basis is achieved.

Description

[0001] This application is a divisional application of the invention patent application "Gene Controlling Rice Fertility and Its Encoded Protein and Application" (application number: 201210057952.8) filed on March 7, 2012. technical field [0002] The invention belongs to the field of plant fertility genes. It specifically relates to the method of using RNAi technology to control rice fertility genes to obtain rice sterile lines Background technique [0003] Rice is a self-pollinated crop. For a long time, the improvement of rice varieties has mainly relied on hybrid breeding methods. However, due to the limitations of artificial castration and hybridization techniques, usually only a small number of parents can be used for hybridization. Difficult to breed breakthrough breeds. The main agronomic traits of rice are mostly quantitative traits controlled by micro-effect multi-genes. Recurrent selection breeding method can break the linkage of unfavorable genes and increase th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C12N15/113C12N15/11A01H5/00
Inventor李仕贵钦鹏王玉平涂兵马炳田邓路长
OwnerSICHUAN AGRI UNIV