A Huperzia serrata endophytic fungus and its application in the preparation of 8α, 15α-epoxidized huperzine A

A technology of endophytic fungus and Huperzia serrata, applied in the field of biochemistry, can solve the problems of inability to meet the needs of industrial production, low conversion rate, and shortage of clinical drugs, and achieve high conversion rate, easy strains, and simple fermentation conditions.

Active Publication Date: 2016-04-13
ZHEJIANG UNIV OF TECH
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] The present invention finds another way, takes fungus (especially endophytic fungus of Huperzia serrata) as the screening object, and through a large amount of creative experimental intellectual labor, screens and obtains a strain of cereus tearing fungus, and through the fermentation and transformation of the strain, Huperzia serrata 8α, 15α-epoxidized huperzine A was prepared as a substrate, which solved the low conversion rate of 8α, 15α-epoxidized huperzine A in the prior art, which could not meet the needs of industrial production and the shortage of clinical drugs. defect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Huperzia serrata endophytic fungus and its application in the preparation of 8α, 15α-epoxidized huperzine A
  • A Huperzia serrata endophytic fungus and its application in the preparation of 8α, 15α-epoxidized huperzine A
  • A Huperzia serrata endophytic fungus and its application in the preparation of 8α, 15α-epoxidized huperzine A

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Separation of endophytic fungus (Ceriporialacerate) HS-ZJUT-C13A of Hupernia serrata

[0037] (1) Collection of samples

[0038] The samples were Huperziaserrata plants collected from Gaoer Township, Pan'an County, Jinhua City, Zhejiang Province in August 2010.

[0039] (2) Isolation of strains

[0040] Wash the epidermis and roots of the collected plants with tap water, immerse the washed samples in a container filled with 75% ethanol, take them out after 2 minutes, rinse them with sterile water for 3 to 5 times, and then immerse them in a container filled with 0.1% ethanol Keep it in the container of mercuric chloride solution for 1 minute, take it out, and rinse with a large amount of sterile water to remove the residual mercuric chloride solution. Under sterile conditions, use sterilized tweezers and blades to peel off the outer skin of the stems of Huperus serrata stems, then cut into 0.3cm×0.3cm tissue pieces and plant them on PDA medium, and culture t...

Embodiment 2

[0043] Example 2 Molecular biological identification of Huperzia serrata endophyte (Ceriporialacerate) HS-ZJUT-C13A

[0044] (1) Extraction of DNA

[0045] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelium with liquid nitrogen, and extract the genomic DNA with the SK1375 genomic DNA extraction kit (manufacturer: Sangon Bioengineering (Shanghai) Co., Ltd.) Sugar gel electrophoresis.

[0046] (2) PCR amplification of ITS region sequence

[0047] The primer sequences are: ITS1: 5'TCCGTAGGTGAACCTGCGG3'; ITS4: 5'TCCTCCGCTTATTGATATGC3'.

[0048] The PCR system (50 μL) is composed of: Template (genome) 10 pmol, Primer1 (10 μM) 1 μL, Primer2 (10 μM) 1 μL, dNTPmix (10Mmeach) 1 μL, 10×TaqreactionBuffer 5 μL, Taq (5U / μL) 0.25 μL, add water to 50 μL.

[0049] The PCR program was set as follows: 98°C pre-denaturation for 5 minutes, 95°C denaturation for 35 seconds, 55°C renaturation for 35 seconds, 72°C extension for 40 s...

Embodiment 3

[0065] Example 3 The method for preparing 8α, 15α-epoxidized Huperzine A by transforming the endophytic fungus (Ceriporialacerate) HS-ZJUT-C13A

[0066] (1) Strain activation

[0067] Potato glucose agar medium: 200g of peeled potatoes, 20g of glucose, 15g of agar, 1000mL of water, make a test tube slope, pick mycelium and inoculate it on the test tube slope, culture at 28°C for 7 days;

[0068] (2) Fermentation and transformation

[0069] Potato glucose liquid medium: 200g peeled potatoes and cut into about 2cm 2 Put the small pieces in a beaker and boil for 30 minutes, then filter with double gauze, take the filtrate and add 20g of glucose, add water to make up to 1000mL.

[0070] Inoculate 350 250mL Erlenmeyer flasks (with 100mL potato dextrose liquid medium in the bottle, sterilized at 121C) with the activated Huperdoria serrata HS-ZJUT-C13A strain, at 28°C and 180°C. Shake the culture at rpm. After culturing for 6 days, under aseptic conditions, add 0.3 mL of huperzin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a huperzia serrate endophytic fungus which is obtained from a pteridophyte, namely, a huperzia serrate plant by adopting a separating and purifying technology, is named Ceriporia lacerate HS-ZJUT-C13A and is collected in the China Center for Type Culture Collection on October 28, 2012 with the collection number CCTCC M 2012433. The strain provided by the invention can be used for preparing a compound, namely, 8alpha, 15alpha-epoxydized huperzine A with a nerve protection effect. A conversion method has the advantages of simple fermentation conditions, high substrate conversion rate and the like, is easily cultures the strain, has the potential of industrial large-scale production, is a novel way for obtaining the compound, protects valuable and rare medicinal huperziaceae plant resources from being damaged and can provide a novel thought for reliving the current situation of lack of huperzine A in clinical administration.

Description

technical field [0001] The invention relates to the technical field of biochemistry, in particular to an endophytic fungus of Huperzia serrata and its application in the preparation of 8α, 15α-epoxidized huperzine A. The application mainly refers to the preparation of 8α, 15α-epoxide by the method of microbial transformation Huperzine A oxide. Background technique [0002] Huperzine A (huperzineA) is an alkaloid compound derived from Huperziaserrata, a plant of the genus Lycopodium in the Lycopodium family. A large number of scientific studies have shown that huperzine A has an efficient, reversible and highly selective inhibitory effect on central acetylcholinesterase (ACHE), which can be used to treat Alzheimer's disease (AD) Memory impairment and vascular dementia have significant curative effect. Therefore, huperzine A has been widely concerned by researchers, and the research hotspots mainly focus on the chemical synthesis, structure modification, activity evaluation,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C12P17/18C12R1/645
Inventor 单伟光应优敏占扎君
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap