A Huperzia serrata endophytic fungus and its application in the preparation of 8α, 15α-epoxidized huperzine A
A technology of endophytic fungus and Huperzia serrata, applied in the field of biochemistry, can solve the problems of inability to meet the needs of industrial production, low conversion rate, and shortage of clinical drugs, and achieve high conversion rate, easy strains, and simple fermentation conditions.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Separation of endophytic fungus (Ceriporialacerate) HS-ZJUT-C13A of Hupernia serrata
[0037] (1) Collection of samples
[0038] The samples were Huperziaserrata plants collected from Gaoer Township, Pan'an County, Jinhua City, Zhejiang Province in August 2010.
[0039] (2) Isolation of strains
[0040] Wash the epidermis and roots of the collected plants with tap water, immerse the washed samples in a container filled with 75% ethanol, take them out after 2 minutes, rinse them with sterile water for 3 to 5 times, and then immerse them in a container filled with 0.1% ethanol Keep it in the container of mercuric chloride solution for 1 minute, take it out, and rinse with a large amount of sterile water to remove the residual mercuric chloride solution. Under sterile conditions, use sterilized tweezers and blades to peel off the outer skin of the stems of Huperus serrata stems, then cut into 0.3cm×0.3cm tissue pieces and plant them on PDA medium, and culture t...
Embodiment 2
[0043] Example 2 Molecular biological identification of Huperzia serrata endophyte (Ceriporialacerate) HS-ZJUT-C13A
[0044] (1) Extraction of DNA
[0045] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelium with liquid nitrogen, and extract the genomic DNA with the SK1375 genomic DNA extraction kit (manufacturer: Sangon Bioengineering (Shanghai) Co., Ltd.) Sugar gel electrophoresis.
[0046] (2) PCR amplification of ITS region sequence
[0047] The primer sequences are: ITS1: 5'TCCGTAGGTGAACCTGCGG3'; ITS4: 5'TCCTCCGCTTATTGATATGC3'.
[0048] The PCR system (50 μL) is composed of: Template (genome) 10 pmol, Primer1 (10 μM) 1 μL, Primer2 (10 μM) 1 μL, dNTPmix (10Mmeach) 1 μL, 10×TaqreactionBuffer 5 μL, Taq (5U / μL) 0.25 μL, add water to 50 μL.
[0049] The PCR program was set as follows: 98°C pre-denaturation for 5 minutes, 95°C denaturation for 35 seconds, 55°C renaturation for 35 seconds, 72°C extension for 40 s...
Embodiment 3
[0065] Example 3 The method for preparing 8α, 15α-epoxidized Huperzine A by transforming the endophytic fungus (Ceriporialacerate) HS-ZJUT-C13A
[0066] (1) Strain activation
[0067] Potato glucose agar medium: 200g of peeled potatoes, 20g of glucose, 15g of agar, 1000mL of water, make a test tube slope, pick mycelium and inoculate it on the test tube slope, culture at 28°C for 7 days;
[0068] (2) Fermentation and transformation
[0069] Potato glucose liquid medium: 200g peeled potatoes and cut into about 2cm 2 Put the small pieces in a beaker and boil for 30 minutes, then filter with double gauze, take the filtrate and add 20g of glucose, add water to make up to 1000mL.
[0070] Inoculate 350 250mL Erlenmeyer flasks (with 100mL potato dextrose liquid medium in the bottle, sterilized at 121C) with the activated Huperdoria serrata HS-ZJUT-C13A strain, at 28°C and 180°C. Shake the culture at rpm. After culturing for 6 days, under aseptic conditions, add 0.3 mL of huperzin...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com